Разное

Митохондриальная дисфункция: Дисфункция митохондрий при нейродегенеративных заболеваниях

Содержание

Митохондриальная дисфункция при метаболическом синдроме uMEDp

В последние годы особый интерес отечественных и зарубежных исследователей вызывает проблема профилактики и лечения жировой болезни печени как компонента метаболического синдрома. Значительное место в патогенезе жировой болезни печени занимают митохондриальные дисфункции. Этому вопросу был посвящен доклад заведующего кафедрой фармакологии и клинической фармакологии Санкт-Петербургской государственной химико-фармацевтической академии, д.м.н., профессора кафедры пропедевтики внутренних болезней Военно-медицинской академии (Санкт-Петербург) Сергея Владимировича ОКОВИТОГО, прозвучавший в рамках ежегодного конгресса «Гепатология сегодня».

Сергей Владимирович Оковитый


В основе морфологических, биохимических и функциональных изменений при жировой болезни (ЖБП) печени лежат гиперпродукция свободных жирных кислот (СЖК), увеличение их поступления в печень, а также гиперактивация свободнорадикального окисления (СРО). На фоне усиления СРО возрастает интенсивность перекисного окисления липидов (ПОЛ). Избыточное отложение жира в гепатоцитах приводит к развитию жировой дистрофии. Гиперпродукция и окисление СЖК в митохондриях способствуют образованию свободных радикалов, которые подавляют выработку клеточных антиоксидантов. Следствием этого становятся окислительный стресс и клеточный энергодефицит.


Таким образом, при ЖБП избыточный пул свободных радикалов способствует повреждению сначала митохондриальных структур, затем клеточных мембран в целом, гибели клетки путем некроза или быстрой инициации апоптоза. Все это приводит к достаточно выраженному фибротическому повреждению органа, усугубляя гипоксию.


Тем временем активация свободнорадикальных процессов продолжается. В результате избытка СЖК, поступающих в печень в большом количестве, в частности, из жировой ткани, развиваются гипоксические изменения, усиливается тканевая гипоксия и митохондриальная дисфункция, гиперактивация СРО.


Данные процессы инициируются прежде всего за счет гипоксии, а не нарушения кровоснабжения и микроциркуляции в печени, поскольку в момент, когда включаются компенсаторные механизмы активации энергопродукции, запускается и продукция избыточного количества радикалов. Учитывая, что при ЖБП клетка существует в условиях энергодефицита, продукции естественных антиоксидантных систем не хватает для нейтрализации процесса. Начинается прогрессивное поражение печени с повреждением ее митохондрий.


Многие специалисты рассматривают гипоксию как один из ведущих факторов, влияющих на развитие ЖБП, поскольку при ЖБП промежуточным звеном между избыточным поступлением СЖК и развитием окислительного стресса является тканевая гипоксия. Именно гипоксические явления, сопряженные с дефицитом аденозинтрифосфата и нарушением митохондриального окисления, приводят к активации СРО, роль которого в патогенезе заболеваний печени сегодня хорошо известна. При этом во всех тканях происходят изменения вследствие индукции факторов, защищающих клетку от гипоксии.


Важнейшую роль при тканевой гипоксии играет кислородчувствительный протеиновый комплекс – гипоксия-индуцибельный фактор, который активируется в местах регуляции кислородных путей и обеспечивает быстрый ответ на гипоксию. Но этот же фактор будет отвечать и за неоплазию гепатоцита.


Факторы развития ЖБП усиливаются под действием митохондриальной дисфункции с нарушением митохондриального окислительного фосфорилирования, повреждением эндоплазматического ретикулума, изменением генной активности, в том числе генов, отвечающих за глюконеогенез, транспорт глюкозы, с одновременным увеличением синтеза провоспалительных цитокинов и нарушением в итоге углеводного и липидного обмена.


Гипоксия, независимо от типа (тканевая или интермиттирующая), приводит к появлению состояний, характерных для метаболического синдрома: инсулинорезистентности, нарушению функции жировой ткани, сердца, эндотелиальной дисфункции.


Развитие жировой дистрофии у пациентов с вирусными гепатитами, в том числе не употребляющих алкоголь, также тесно связано с митохондриальной дисфункцией. Место первичной репликации вируса гепатита C – митохондрии гепатоцитов. Он может вызвать митохондриальную дисфункцию, что повышает риск развития печеночной недостаточности, фиброзирования. На фоне митохондриальной дисфункции усугубляются стеатоз, инсулинорезистентность, апоптоз, фиброз печени.


Иногда к развитию ЖБП приводят мутации генов. В частности, это дефект в деацитилировании митохондриальных белков. Белки, которые в норме должны деацитилировать ряд мембранных белков митохондрий, практически не работают. В результате резко снижается активность метаболических ферментов, возрастают инсулинорезистентность, выраженность ожирения, стеатоза и воспаления, ЖБП быстро прогрессирует и развивается стеатогепатит1.


Перицеллюлярный фиброз у пациентов, имеющих гипоксические эпизоды, – необратимый фактор. Формируется перицеллюлярный фиброз с нарушением обменных процессов между клетками, образованием цирротических изменений и нарушением кровоснабжения с ухудшением микроциркуляции. Это приводит к развитию тяжелых осложнений и развитию перманентной гипоксии, которая будет сопровождаться неконтролируемым ростом СРО и в итоге спровоцирует гибель органа.


При гипоксии, развивающейся в случае ЖБП и фиброза, в клетке в первую очередь наступают изменения в митохондриях, за исключением жировых вакуолей, формирующихся еще ранее. Количество митохондрий не сопровождается увеличением плотности их внутренних мембран. При ЖБП и фиброзе возрастает объем митохондрий. Образуются гигантские митохондрии, заполняющие большую площадь клетки, но продуцирующие энергии меньше, чем совокупность неизмененных митохондрий в нормальной клетке. Развивается тяжелый энергодефицит.


Этиологические факторы возникновения митохондриальной дисфункции разнообразны: нарушение бета-окисления, прием лекарственных средств и алкоголя, действие вирусных агентов и др.


Активация сукцинат-оксидазного окисления в условиях гипоксии способствует коррекции физиологических процессов в клетке на уровне митохондрий – нормализует электрон-транспортную функцию дыхательной цепи, активирует ферменты. Это ненадолго облегчает поступление кислорода в клетку и восстанавливает аэробный энергетический обмен. Между тем активация сукцинат-оксидазного окисления не может длиться бесконечно, поскольку является временным компенсаторным механизмом.


В условиях дефицита антиоксидантного субстрата, активной работы цитохромов, которые начинают окислять избыток жирных кислот, усиливается процесс пероксидации. Возрастание активности провоспалительных ферментов и других факторов приводит к поддержанию и развитию воспалительного процесса.


В настоящее время ученые рассматривают подходы к компенсации митохондриальных нарушений с помощью методов биомедицины.


При традиционном способе коррекции митохондриальных нарушений при гипоксии современная медицина использует вещества, способные защитить клетку от гипоксии.


Сукцинатсодержащие препараты обладают антигипоксантным, антиоксидантным, мембраностабилизирующим и детоксицирующим действием. Экзогенно вводимый сукцинат (янтарная кислота) при гипоксии поддерживает активность сукцинатдегидрогеназного звена – ФАД-зависимого звена цикла Кребса, менее чувствительного к гипоксии по сравнению с НАД-зависимыми оксидазами. Окисление сукцината наиболее устойчиво к оксидативному повреждению. Это позволяет определенное время поддерживать энергопродукцию в клетке при наличии в митохондриях субстрата окисления, в данном звене – сукцината. Таким образом, превращение янтарной кислоты в организме связано с производством энергии, необходимой для обеспечения жизнедеятельности. Благодаря уникальным свойствам янтарная кислота считается универсальным гепатотропным препаратом для применения при различных поражениях печени как в лечебных, так и в лечебно-профилактических целях.


Сегодня на фармацевтическом рынке представлен отечественный препарат Ремаксол (компания-производитель «ПОЛИСАН»). Это не только сбалансированный полиионный инфузионный раствор. В его состав входят также физиологически активные компоненты – янтарная кислота, метионин, инозин и никотинамид. Препарат Ремаксол не только оказывает гепатопротекторный эффект, но и улучшает энергетическое обеспечение гепатоцитов, повышает устойчивость мембран гепатоцитов к ПОЛ, восстанавливает активность ферментов антиоксидантной защиты.


Эффективность применения препарата Ремаксол в терапии ЖБП обусловлена воздействием на основные механизмы развития повреждения печени, что позволяет корригировать митохондриальную дисфункцию, повреждение мембран гепатоцитов и окислительный стресс. Препарат Ремаксол может быть использован как средство инициальной терапии в рамках патогенетеческого лечения, а также при невозможности элиминации этиологического фактора. Указанные гепатопротекторные свойства Ремаксола делают его перспективным в лечении нарушений функции печени. 

Митохондриальная ДНК как фактор развития глаукомной оптической нейропатии | Газизова

1. Quigley H.A., Broman A.T. The number of people with glaucoma worldwide in 2010 and 2020. Br J Ophthalmol. 2006;90(3):262–267. DOI: 10.1136/bjo.2005.081224

2. Tham Y.C., Li X., Wong T.Y., Quigley H.A., Aung T., Cheng C.Y. Global prevalence of glaucoma and projections of glaucoma burden through 2040: a systematic review and meta‑analysis. Ophthalmol. 2014;121:2081–2090. DOI: 10.1016/j.ophtha.2014.05.013

3. Sharif N.A. Glaucomatous optic neuropathy treatment options: the promise of novel therapeutics, techniques and tools to help preserve vision. Neural Regen Res. 2018;13(7):1145–1150. DOI: 10.4103/1673‑5374.235017

4. Inman D.M., Harun‑Or‑Rashid M. Metabolic Vulnerability in the Neurodegenerative Disease Glaucoma. Front Neurosci. 2017;11:146. Published 2017 Mar 30. DOI: 10.3389/fnins.2017.00146

5. Calkins D.J., Horner P.J. The cell and molecular biology of glaucoma: axonopathy and the brain. Invest Ophthalmol Vis Sci. 2012;53(5):2482–2484. DOI: 10.1167/iovs.12‑9483i

6. Casson R.J., Chidlow G., Wood J.P., Crowston J.G., Goldberg I. Definition of glaucoma: clinical and experimental concepts. Clin Experiment Ophthalmol. 2012;40:341–349. DOI: 10.1111/j.1442‑9071.2012.02773.x

7. Авдеев, Р.В., Александров, А.С., Бакунина, Н.А., Басинский и др. Модель первичной открытоугольной глаукомы: манифестирование и исходы. Клиническая медицина. 2014;12:64–72.

8. Kong Y.X., Coote M.A., O’Neill E.C., Gurria L.U., Vie J., Garway‑Heath D., Medeiros F.A., Crowston J.G. Glaucomatous optic neuropathy evaluation project: a standardized internet system for assessing skills in optic disc examination. Clin Experiment Ophthalmol. 2011;39:308–317. DOI: 10.1111/j.1442‑9071.2010.02462.x

9. Osborne N.N., Núñez‑Álvarez C., Joglar B., et al. Glaucoma: Focus on mitochondria in relation to pathogenesis and neuroprotection. Eur J Pharmacol. 2016;Sep:15(787):127–133. DOI: 10.1016/j.ejphar.2016.04.032

10. Yang X.J., Ge J., Zhuo Y.H. Role of mitochondria in the pathogenesis and treatment of glaucoma. Chin Med J (Engl). 2013;126(22):4358‑4365.

11. Kamel K., Farrell M., O’Brien C. Mitochondrial dysfunction in ocular disease: Focus on glaucoma. Mitochondrion. 2017;35:44–53. DOI: 10.1016/j.mito.2017.05.004

12. Munemasa Y., Kitaoka Y., Kuribayashi J., Ueno S. Modulation of mitochondria in the axon and soma of retinal ganglion cells in a rat glaucoma model. J Neurochem. 2010;115:1508–1519. DOI: 10.1111/j.1471‑4159.2010.07057.x

13. Ju W., Liu Q., Kim K., Crowston J.G., Linsey J.D., Agarwal N., Ellisman M.H., Perkins G. A., Weinreb R.N. Elevated hydrostatic pressure triggers mitochondrial fission and decreases cellular ATP in differentiated RGC‑5 cells. Invest Ophthalmol & Visual Science. 2007;48:2145–2151. DOI: 10.1167/iovs.06‑0573

14. Barron M.J., Griffiths P., Turnbull D.M., Bates D., Nichols P. The distributions of mitochondria and sodium channels reflect the specific energy requirements and conduction properties of the human optic nerve head. Br J Ophthalmol. 2004;88(2):286–290. DOI: 10.1136/bjo.2003.027664

15. Izzotti A., Sacca S.C., Longobardi M. Cartiglia C. Mitochondrial damage in the trabecular meshwork of patients with glaucoma. Archives of Ophthalmology. 2010;128:724–730. DOI: 10.1001/archophthalmol.2010.87

16. Alekseev V., Gazizova I. Morphological changes in the mitochondria of cells of trabecular zone in patients with primary open‑angle glaucoma. 10th European Glaucoma Society Congress Copenhagen. (Accessed 09.04.2019).

17. Harun‑Or‑Rashid M., Pappenhagen N., Palmer P.G., Smith M.A., Gevorgyan V. Structural and Functional Rescue of Chronic Metabolically Stressed Optic Nerves through Respiration. The Journal of Neuroscience. 2018;38(22):5122–5139. DOI: 10.1523/jneurosci.3652‑17.2018

18. DiMauro S., Schon E., Carelli V., Hirano M. The clinical maze of mitochondrial neurology. Nature Reviews Neurology. 2013;9(8):429–444. DOI: 10.1038/nrneu‑rol.2013.126

19. Joseph J., Denisova N., Bielinski D., Fisher D., Shukitt‑Hale B. Oxidative stress protection and vulnerability in aging: putative nutritional implications for intervention. Mech Ageing Dev. 2000;116(2‑3):141–153. DOI: 10.1016/s0047‑6374(00)00128‑7

20. Olanow C. An introduction to the free radical hypothesis in Parkinson’s disease. Ann Neurol. 1992;32(S1):S2–S9. DOI: 10.1002/ana.410320703

21. Chrysostomou V., Rezania F., Trounce I., Crowston J. Oxidative stress and mitochondrial dysfunction in glaucoma. Curr Opin Pharmacol. 2013;13(1):12–15. DOI: 10.1016/j.coph.2012.09.008

22. Ito Y., Di Polo A. Mitochondrial dynamics, transport, and quality control: A bottleneck for retinal ganglion cell viability in optic neuropathies. Mitochondrion. 2017;36:186−192. DOI: 10.1016/j.mito.2017.08.014

23. Cordeiro M.F., Normando E.M., Cardoso M.J., Miodragovic S., Jeylani S., Davis B.M., Guo L., Ourselin S., A’hern R., Bloom P.A. Real‑time imaging of single neuronal cell apoptosis in patients with glaucoma. Brain. 2017;140(6):1757−1767. DOI: 10.1093/brain/awx088

24. Lascaratos G., Garway‑Heath D., Willoughby C., Chau K., Schapira A. Mitochondrial dysfunction in glaucoma: Understanding genetic influences. Mitochondrion. 2012;12(2):202−212. DOI: 10.1016/j.mito.2011.11.004

25. Saccà S., Izzotti A., Rossi P., Traverso C. Glaucomatous outflow pathway and oxidative stress. Exp Eye Res. 2007;84(3):389−399. DOI: 10.1016/j.exer.2006.10.008

26. Cooper J., Mann V., Schapira A. Analyses of mitochondrial respiratory chain function and mitochondrial DNA deletion in human skeletal muscle: Effect of ageing. J Neurol Sci. 1992;113(1):91−98. DOI: 10.1016/0022‑510X(92)90270‑U

27. Ojaimi J., Masters C., Opeskin K., McKelvie P., Byrne E. Mitochondrial respiratory chain activity in the human brain as a function of age. Mech Ageing Dev. 1999;111(1):39−47. DOI: 10.1016/S0047‑6374(99)00071‑8

28. Boveris A., Navarro A. Brain mitochondrial dysfunction in aging. IUBMB Life. 2008;60(5):308−314. DOI: 10.1002/iub.46

29. Navarro A., Boveris A. The mitochondrial energy transduction system and the aging process. American Journal of Physiology-Cell Physiology. 2007;292(2):C670−C686. DOI: 10.1152/ajpcell.00213.2006

30. Calandrella N., Scarsella G., Pescosolido N., Risuleo G. Degenerative and apoptotic events at retinal and optic nerve level after experimental induction of ocular hypertension. Mol Cell Biochem. 2007;301(1−2):155−163. DOI: 10.1007/s11010‑006‑9407‑0

31. Мазунин И.О., Володько Н.В. Наследственная оптическая нейропатия Лебера. Вестник офтальмологии. 2018;134(2):92. DOI: 10.17116/oftalma2018134292‑96

32. Kasahara A., Scorrano L. Mitochondria: from cell death executioners to regulators of cell differentiation. Trends Cell Biol. 2014;24(12):761−770. DOI: 10.1016/j.tcb.2014.08.005

33. Chen M., Liu B., Ma J., Ge J., Wang K. Protective effect of mitochondria‑targeted peptide MTP‑131 against oxidative stress‑induced apoptosis in RGC‑5 cells. Mol Med Rep. 2017;15(4):2179−2185. DOI: 10.3892/mmr.2017.6271

34. Lv B., Chen T., Xu Z., Huo F., Wei Y., Yang X. Crocin protects retinal ganglion cells against h3O2‑induced damage through the mitochondrial pathway and activation of NF‑κB. Int J Mol Med. 2015;37(1):225−232. DOI: 10.3892/ijmm.2015.2418

35. Ju W.K., Kim K.Y., Lindsey J.D., Angert M., Patel A., Scott R.T., Liu Q., Crowston J.G., Ellisman M.H., Perkins G.A., Weinreb R.N. Elevated hydrostatic pressure triggers release of OPA1 and cytochrome C, and induces apoptotic cell death in differentiated RGC‑5 cells. Mol Vis. 2009;15:120–134.

36. Mazunin I., Volodko N., Starikovskaya E., Sukernik R. Mitochondrial genome and human mitochondrial diseases. Mol Biol (NY). 2010;44(5):665−681. DOI: 10.1134/s0026893310050018

37. Patrushev M., Kamenski P., Mazunin I. Mutations in mitochondrial DNA and approaches for their correction. Biochemistry (Moscow). 2014;79(11):1151−1160. DOI: 10.1134/S0006297914110029

38. Torroni A., Achilli A., Macaulay V., Richards M., Bandelt H. Harvesting the fruit of the human mtDNA tree. Trends in Genetics. 2006;22(6):339−345. DOI: 10.1016/j.tig.2006.04.001

39. Wallace D. Mitochondrial genetic medicine. Nat Genet. 2018;50(12):1642−1649. DOI: 10.1038/s41588‑018‑0264‑z

40. Latorre‑Pellicer A., Moreno‑Loshuertos R., Lechuga‑Vieco A.V., Sánchez‑Cabo F., Torroja C., Acín‑Pérez R., Calvo E., Aix E., González‑Guerra A., Logan A., Bernad-Miana M.L., Romanos E., Cruz R., Cogliati S., Sobrino B., Carracedo Á., Pérez‑Martos A., Fernández‑Silva P., Ruíz‑Cabello J., Murphy M.P., Flores I., Vázquez J., Enríquez J.A. Mitochondrial and nuclear DNA matching shapes metabolism and healthy ageing. Nature. 2016;535(7613):561−565. DOI: 10.1038/nature18618

41. Morava E., Kozicz T., Wallace D. The phenotype modifier: is the mitochondrial DNA background responsible for individual differences in disease severity. J Inherit Metab Dis. 2019;42(1):3‑4. DOI: 10.1002/jimd.12050

42. Abu‑Amero K., Morales J., Bosley T. Mitochondrial Abnormalities in Patients with Primary Open‑Angle Glaucoma. Investigative Opthalmology & Visual Science. 2006;47(6):2533. DOI: 10.1167/iovs.05‑1639

43. Banerjee D., Banerjee A., Mookherjee S., Vishal M., Mukhopadhyay A., Sen A., Basu A., Ray K. Mitochondrial Genome Analysis of Primary Open Angle Glaucoma Patients. PLoS ONE. 2013;8(8):e70760. DOI: 10.1371/journal.pone.0070760

44. Collins D.W., Gudiseva H.V., Trachtman B.T., Jerrehian M., Gorry T., Merritt III W.T., Rhodes A.L., Sankar P.S., Regina M., Miller‑Ellis E., O’Brien J.M. Mitochondrial Sequence Variation in African‑American Primary Open‑Angle Glaucoma Patients. PLoS ONE. 2013;8(10):e76627. DOI: 10.1371/journal.pone.0076627

45. Jeoung J., Seong M., Park S., Kim D., Kim S., Park K. Mitochondrial DNA Variant Discovery in Normal‑Tension Glaucoma Patients by Next‑Generation Sequencing. Investigative Opthalmology & Visual Science. 2014;55(2):986. DOI: 10.1167/iovs.13‑12968

46. Sundaresan P., Simpson D., Sambare C., Duffy S., Lechner J., Dastane A., Dervan E.W., Vallabh N., Chelerkar V., Deshpande M., O’Brien C., McKnight A.J., Willoughby C.E. Whole‑mitochondrial genome sequencing in primary open‑angle glaucoma using massively parallel sequencing identifies novel and known pathogenic variants. Genetics in Medicine. 2014;17(4):279−284. DOI: 10.1038/gim.2014.121

47. Yi Q., Deng G., Zhou H., Wu G., Tang L. Mitochondrial transfer RNA variants and primary congenital glaucoma. Mitochondrial DNA. 2015:1−3. DOI: 10.3109/19401736.2015.1028050

48. Inoue‑Yanagimachi M., Himori N., Sato K., Kokubun T., Asano T., Shiga Y., Tsuda S., Kunikata H., Nakazawa T. Association between mitochondrial DNA damage and ocular blood flow in patients with glaucoma. British Journal of Ophthalmology. 2018:bjophthalmol‑2018‑312356. DOI: 10.1136/bjophthalmol‑2018‑312356

49. Singh L.N., Crowston J.G., Lopez Sanchez M.I., Van Bergen N.J., Kearns L.S., Hewitt A.W., Yazar S., Mackey D.A., Wallace D.C., Trounce I.A. Mitochondrial DNA Variation and Disease Susceptibility in Primary Open‑Angle Glaucoma. Investigative Opthalmology & Visual Science. 2018;59(11):4598. DOI: 10.1167/iovs.18‑25085

50. Gudiseva H., Pistilli M., Salowe R., Singh L.N., Collins D.W., Cole B., He J., Merriam S., Khachataryan N., Henderer J., Addis V., Cui Q.N., Sankar P.V., Miller‑Ellis E., Chavali V.R., Ying G.S., Wallace D., O’Brien J.M. The association of mitochondrial DNA haplogroups with POAG in African Americans. Exp Eye Res. 2019;181:85–89. DOI: 10.1016/j.exer.2019.01.015

51. Gorman G., McFarland R., Stewart J., Feeney C., Turnbull D. Mitochondrial donation: from test tube to clinic. The Lancet. 2018;392(10154):1191–1192. DOI: 10.1016/S0140‑6736(18)31868‑3

52. Eyre‑Walker A. Mitochondrial Replacement Therapy: Are Mito‑nuclear Interactions Likely To Be a Problem? Genetics. 2017;205(4):1365–1372. DOI: 10.1534/genetics.116.196436

53. Labarta E., de los Santos M.J., Herraiz S., Escribá M.J., Marzal A., Buigues A., Pellicer A. Autologous mitochondrial transfer as a complementary technique to intracytoplasmic sperm injection to improve embryo quality in patients undergoing in vitro fertilization — a randomized pilot study. Fertil Steril. 2019;111(1):86–96. DOI: 10.1016/j.fertnstert.2018.09.023

54. Bacman S., Pereira C., Moraes C. Targeted Mitochondrial Genome Elimination. Mitochondrial Biology and Experimental Therapeutics. 2018:535–563. DOI: 10.1007/978‑3‑319‑73344‑9_24

55. Reddy P., Ocampo A., Suzuki K., Luo J., Bacman S.R., Williams S.L., Sugawara A., Okamura D., Tsunekawa Y., Wu J., Lam D., Xiong X., Montserrat N., Esteban C.R., Liu G.H., Sancho‑Martinez I., Manau D., Civico S., Cardellach F., O’Callaghan M., Campistol J., Zhao H., Campistol J.M., Moraes C.T., Belmonte J. Selective Elimination of Mitochondrial Mutations in the Germline by Genome Editing. Cell. 2015;161(3):459–469. DOI: 10.1016/j.cell.2015.03.051

56. Yang Y., Wu H., Kang X., Liang Y., Lan T., Li T., Tan T., Peng J., Zhang Q., An G., Liu Y., Yu Q., Ma Z., Lian Y., Soh B.S. Targeted elimination of mutant mitochondrial DNA in MELAS‑iPSCs by mitoTALENs. Protein Cell. 2018;9(3):283–297. DOI: 10.1007/s13238‑017‑0499‑y

57. McCann B., Cox A., Gammage P., Stewart J., Zernicka‑Goetz M., Minczuk M. Delivery of mtZFNs into Early Mouse Embryos. Methods in Molecular Biology. 2018:215–228. DOI: 10.1007/978‑1‑4939‑8799‑3_16

58. Bacman S.R., Kauppila J.H., Pereira C.V., Nissanka N., Miranda M., Pinto M., Williams S.L., Larsson N.G., Stewart J.B., Moraes C.T. MitoTALEN reduces mutant mtDNA load and restores tRNAAla levels in a mouse model of heteroplasmic mtDNA mutation. Nat Med. 2018;24(11):1696–1700. DOI: 10.1038/s41591‑018‑0166‑8

59. Gammage P.A., Viscomi C., Simard M.L., Costa A.S., Gaude E., Powell C.A., Haute L.V., McCann B.J., Rebelo‑Guiomar P., Cerutti R., Zhang L., Rebar E.J., Zeviani M., Frezza C., Stewart J.B., Minczuk M. Genome editing in mitochondria corrects a pathogenic mtDNA mutation in vivo. Nat Med. 2018;24(11):1691–1695. DOI: 10.1038/s41591‑018‑0165‑9

60. Jinek M., Chylinski K., Fonfara I., Hauer M., Doudna J., Charpentier E. A Programmable Dual‑RNA‑Guided DNA Endonuclease in Adаptive Bacterial Immunity. Science. 2012;337(6096):816–821. DOI: 10.1126/science.1225829

61. Gammage P., Moraes C., Minczuk M. Mitochondrial Genome Engineering: The Revolution May Not Be CRISPR‑Ized. Trends in Genetics. 2018;34(2):101–110. DOI: 10.1016/j.tig.2017.11.001

62. Jo A., Ham S., Lee G., Lee Y., Kim S., Lee Y., Shin J., Le Y. Efficient Mitochondrial Genome Editing by CRISPR/Cas9. Biomed Res Int. 2015;2015:1–10. DOI: 10.1155/2015/305716

63. Loutre R., Heckel A., Smirnova A., Entelis N., Tarassov I. Can Mitochondrial DNA be CRISPRized: Pro and Contra. IUBMB Life. 2018;70(12):1233–1239. DOI: 10.1002/iub.1919

64. Verechshagina N., Nikitchina N., Yamada Y., Harashima H., Tanaka M., Orishchenko K., Mazunin I. Future of human mitochondrial DNA editing technologies. Mitochondrial DNA Part A. 2018;30(2):214–221. DOI: 10.1080/24701394.2018.1472773

65. Bian W., Chen Y., Luo J., Wang C., Xie S., Pei D. A knock‑in strategy for editing human and zebrafish mitochondrial DNA using mito‑CRISPR/Cas9 system. ACS Synth Biol. 2019. DOI: 10.1021/acssynbio.8b00411

66. Clay Montier L., Deng J., Bai Y. Number matters: control of mammalian mitochondrial DNA copy number. Journal of Genetics and Genomics. 2009;36(3):125–131. DOI: 10.1016/s1673‑8527(08)60099‑5

67. Nissanka N., Minczuk M., Moraes C. Mechanisms of Mitochondrial DNA Deletion Formation. Trends in Genetics. 2019;35(3):235–244. DOI: 10.1016/j.tig.2019.01.001

68. Nissanka N., Bacman S., Plastini M., Moraes C. The mitochondrial DNA polymerase gamma degrades linear DNA fragments precluding the formation of deletions. Nat Commun. 2018;9(1). DOI: 10.1038/s41467‑018‑04895‑1

69. Peeva V., Blei D., Trombly G., Corsi S., Szukszto M.J., Rebelo‑Guiomar P., Gammage P.A., Kudin A.P., Becker C., Altmüller J., Minczuk M., Zsurska G., Kunz W.S. Linear mitochondrial DNA is rapidly degraded by components of the replication machinery. Nat Commun. 2018;9(1). DOI: 10.1038/s41467‑018‑04131‑w

70. Komor A.C., Zhao K.T., Packer M.S., Gaudelli N.M., Waterbury A.L., Koblan L.W., Kim Y.B., Badran A.H., Liu D.R. Improved base excision repair inhibition and bacteriophage Mu Gam protein yields C:G‑to‑T:A base editors with higher efficiency and product purity. Sci Adv. 2017;3(8):eaao4774. DOI: 10.1126/sciadv.aao4774

71. Gaudelli N.M., Komor A.C., Rees H.A., Packer M.S., Badran A.H., Bryson D.I., Liu D.R. Programmable base editing of A•T to G•C in genomic DNA without DNA cleavage. Nature. 2017;551(7681):464–471. DOI: 10.1038/nature24644

72. Rees H., Liu D. Base editing: precision chemistry on the genome and transcriptome of living cells. Nature Reviews Genetics. 2018;19(12):770–788. DOI: 10.1038/s41576‑018‑0059‑1

73. Komor A., Badran A., Liu D. CRISPR‑Based Technologies for the Manipulation of Eukaryotic Genomes. Cell. 2017;168(1–2):20–36. DOI: 10.1016/j.cell.2016.10.044

74. Kleinstiver B.P., Prew M.S., Tsai S.Q., Topkar V.V., Nguyen N.T., Zheng Z., Gonzales A., Li Z., Peterson R.T., Yeh J.R., Aryee M.J., Joung J.K. Engineered CRISPR‑Cas9 nucleases with altered PAM specificities. Nature. 2015;523(7561):481–485. DOI: 10.1038/nature14592

75. Kleinstiver B.P., Prew M.S., Tsai S.Q., Nguyen N.T., Topkar V.V., Zheng Z., Joung J.K. Broadening the targeting range of Staphylococcus aureus CRISPR‑Cas9 by modifying PAM recognition. Nat Biotechnol. 2015;33(12):1293–1298. DOI: 10.1038/nbt.3404

76. Porteus M. A New Class of Medicines through DNA Editing. New England Journal of Medicine. 2019;380(10):947–959. DOI: 10.1056/nejmra1800729

77. Zarubina T.V., Lukk M.V. Antihypoxic and antioxidant effects of exogenous succinic acid and aminothiol succinate‑containing antihypoxants. Buii Exp Biol. Med. 2012;153(3):336–339. DOI: 10.1007/s10517‑012‑1709‑5

78. Кондрашова М.Н., Хундерякова Н.В., Захарченко М.В. Оригинальный цитобиохимический мeтод выявления индивидуальных различий физиологического сoстояния организма по комплексной характеристике (Паттерну) активности сукцинатдегидрогеназы. Medline.ru Биомедицинский журнал. 2009;10:27–43.

79. Михин В.П. Цитопротекция в кардиологии: достигнутые успехи и перспективы. Архивъ внутренней медицины. 2014;1:44–49. [Mikhin V.P. Cytoprotection in cardiology: achieved succeesses and outlooks. The Russian Archives of internal medicine =Arkhiv vnutrennei meditsiny. 2014;1:44–49 (In Russ.)]

80. Федин А.И. Оксидантный стресс и применение антиоксидантов в неврологии. Нервные болезни. 2002;1:15–18.

81. Yellon D.M., Hausenloy D.J. Myocardial reperfusion injury. N Engl J Med. 2007;357(11):1121–1135. DOI: 10.1056/NEJMra071667

82. Измайлова Т., Федорова Н., Петричук С., Басаргина Е. Митохондриальные нарушения у детей с хронической сердечной недостаточностью: эффекты цитофлавина. Российский педиатрический журнал. 2012;(4):21–22.

83. Почепень О. Оценка эффективности цитофлавина при лечении токсико‑гипоксической энцефалопатии после тяжелой травмы. Журнал неврологии и психиатрии им. С.С.Корсакова. 2010;10:23–29.

84. Газизова И.Р., Тихомирова И.Ю. Роль митохондриальной дисфункции при глаукоме. Медицинский вестник Башкортостана. 2015;10(2):153–156.

85. Гусев А.Н., Красногорская В.Н., Сорокина Е.В., Гусева Е.В. Результаты лечения глаукомной оптической нейропатии с использованием препаратов Цитофлавин и Комбилипен. Современные технологии в офтальмологии. 2015;2:154–155.

86. Малишевская Т.Н., Юсупов А.Р., Шатских С.В., Филиппова Ю.Е., Антипина Н.А., Клиндюк Т.С., Богданова Д.С., Кондратьева Л.А. Исследование эффективности и безопасности применения препарата Цитофлавин у пациентов с первичной открытоугольной глаукомой. Вестник офтальмологии. 2019;135(2):83–92.

Митохондриальные заболевания, комплексная диагностика: митохондриальная ДНК, ч. м. (Mitochondrial Diseases, multiplex mutations detection assay)

Метод определения
Полимеразная цепная реакция (ПЦР).

Исследуемый материал
Цельная кровь (с ЭДТА)

Митохондриальные заболевания клинически представляют собой гетерогенную группу состояний, развивающихся в связи с нарушением работы ферментов дыхательной цепи митохондрий. Нарушения могут быть связаны как с мутациями, появляющимися в геноме человека, так и с мутациями в митохондриальной ДНК (мтДНК). Наиболее часто наблюдаются повреждения мтДНК, которые характеризуются протяженными делециями и дупликациями, а также точечными мутациями (чаще всего 3243A>G, 3460G>A, 8344A>G, 11778G>A, 14484T>C). 

Митохондриальные заболевания могут манифестировать в любом возрасте. При некоторых митохондриальных заболеваниях поражается только один орган (наследственная оптическая нейропатия Лебера), однако в большинстве данная группа состояний имеет системные проявления, чаще всего связанные с поражением нервной и мышечной системы. Довольно часто клинические проявления митохондриальных заболеваний могут подпадать под специфические синдромы: MELAS-синдром (митохондриальная миопатия, энцефалопатия, лактат-ацидоз, инсультоподобные эпизоды), MERRF-синдром (миоклоническая эпилепсия, ассоциированная с порванными красными волокнами), прогрессирующая наружная офтальмоплегия, синдром Кернса-Сейра, синдром Лея, нейрогенная слабость с атаксией и пигментным ретинитом. Однако довольно много клинических случаев митохондриальных заболеваний не подпадают ни под одну из перечисленных категорий, имея перемежающийся спектр проявлений и симптомов, что возможно объясняется гетероплазмией мутаций в мтДНК (вариация количества «мутантных» митохондрий в одной клетке). 

Частыми клиническими проявлениями митохондриальных заболеваний являются блефароптоз, офтальмоплегия, проксимальная миопатия, кардиомиопатия, нейросенсорная тугоухость, атрофия глазного нерва, пигментная ретинопатия, энцефалопатия, судороги, деменция, мигрень, инсультоподобные эпизоды, атаксия, спастичность. 

Мутации в мтДНК могут передаваться по материнской линии. При наличии мутаций в мтДНК мужчины риск передачи аберрации детям отсутствует. Делеции в мтДНК чаще всего возникают de novo (единственный случай в семье), тогда как точечные аберрации и дупликации часто передаются по материнской линии.

Литература

  1. Arpa J. et al. Prevalence and progression of mitochondrial diseases: a study of 50 patients. Muscle Nerve. 2003;28:690-695. 

  2. Chinnery P.F. et al. Risk of developing a mitochondrial DNA deletion disorder. Lancet. 2004;364:592-596.

MITOCHONDRIAL DYSFUNCTION IN CHILDREN WITH HEPATIC FORMS OF GLYCOGEN STORAGE DISEASE — Kurbatova

About the authors

O. V. Kurbatova

Научный центр здоровья детей, Москва, Российская Федерация

Email: [email protected]
Scientific Centre of Children Health, Moscow, Russian Federation

A. N. Surkov

Scientific Centre of Children Health, Moscow, Russian Federation

Author for correspondence.
Email: [email protected]

кандидат медицинских наук, старший научный сотрудник отдела планирования и прогнозирования научных исследований Научного центра здоровья детей. Адрес: 119991, Москва, Ломоносовский проспект, д. 2, стр. 1, тел.: +7 (499) 134-02-76

Russian Federation

L. S. Namazova-Baranova

Scientific Centre of Children Health, Moscow, Russian Federation

Email: [email protected]
доктор медицинских наук, профессор, член-корреспондент РАМН, заместитель директора-директор НИИ профилактической педиатрии и восстановительного лечения Научного центра здоровья детей. Адрес: 119991, Москва, Ломоносовский проспект, д. 2, стр. 1, тел.: +7 (495) 967-14-20 Russian Federation

S. I. Polyakova

Scientific Centre of Children Health, Moscow, Russian Federation

Email: [email protected]

доктор медицинских наук, ведущий научный сотрудник гастроэнтерологического отделения с гепатологической группой Научного центра здоровья детей. Адрес: 119991, Москва, Ломоносовский проспект, д. 2, стр. 1, тел.: +7 (495) 967-14-20

Russian Federation

L. V. Miroshkina

Scientific Centre of Children Health, Moscow, Russian Federation

Email: [email protected]
младший научный сотрудник лаборатории цитохимии Научного центра здоровья детей. Адрес: 119991, Москва, Ломоносовский проспект, д. 2, стр. 1, тел.: +7 (495) 967-14-20 Russian Federation

G. F. Semenova

Scientific Centre of Children Health, Moscow, Russian Federation

Email: [email protected]
доктор биологических наук, ведущий научный сотрудник лаборатории цитохимии Научного центра здоровья детей. Адрес: 119991, Москва, Ломоносовский проспект, д. 2, стр. 1, тел.: +7 (495) 967-14-20 Russian Federation

I. V. Samokhina

Scientific Centre of Children Health, Moscow, Russian Federation

Email: [email protected]
кандидат медицинских наук, научный сотрудник лаборатории цитохимии Научного центра здоровья детей. Адрес: 119991, Москва, Ломоносовский проспект, д. 2, стр. 1, тел.: +7 (495) 967-14-20

E. Yu. Kapustina

Scientific Centre of Children Health, Moscow, Russian Federation

Email: [email protected]
кандидат медицинских наук, научный сотрудник лаборатории цитохимии Научного центра здоровья детей. Адрес: 119991, Москва, Ломоносовский проспект, д. 2, стр. 1, тел.: +7 (495) 967-14-20 Russian Federation

Z. N. Dukhova

Scientific Centre of Children Health, Moscow, Russian Federation

Email: [email protected]

кандидат медицинских наук, научный сотрудник лаборатории цитохимии Научного центра здоровья детей. Адрес: 119991, Москва, Ломоносовский проспект, д. 2, стр. 1, тел.: +7 (495) 967-14-20

Russian Federation

A. S. Potapov

Scientific Centre of Children Health, Moscow, Russian Federation

Email: [email protected]

доктор медицинских наук, профессор, заведующий гастроэнтерологическим отделением с гепатологической группой Научного центра здоровья детей. Адрес: 119991, Москва, Ломоносовский проспект, д. 2, стр. 1, тел.: +7 (495) 967-14-20

Russian Federation

S. V. Petrichuk

Scientific Centre of Children Health, Moscow, Russian Federation

Email: [email protected]
доктор биологических наук, заведующая лабораторией цитохимии Научного центра здоровья детей. Адрес: 119991, Москва, Ломоносовский проспект, д. 2, стр. 1, тел.: +7 (495) 967-14-20

Митохондрии трансформированной клетки как мишень противоопухолевого воздействия | Франциянц

1. Цареградов А.Д., Сухоруков В.С. Митохондриальная медицина — проблемы и задачи. Российский вестник перинатологии и педиатрии. 2012; 4(2): 4–13.

2. Gasparre G, Rossignol R, Sonveaux P. Mitochondria in Cancer. Biochim Biophys Acta Bioenerg. 2017; 1858(8): 553–732. https://doi.org/10.1016/j.bbabio.2017.05.004

3. Picard M, Wallace DC, Burelle Y. The rise of mitochondria in medicine. Mitochondrion. 2016; 30: 105–116. https://doi.org/10.1016/j.mito.2016.07.003

4. Heekimi S, Wang Y, Noe A. Mitochondrial ROS and the effectors of the intrinsic apoptotic pathway in aging cells: the discerning killers! Front. Genet. 2016; 7: 161. https://doi.org/10.3389/fgene.2016.00161

5. Redza-Dutordoir M, Averill-Bates DA. Activation of apoptosis signalling pathways by reactive oxygen species. Biochim. Biophys. Acta. 2016; 1863(12): 2977–2992. https://doi.org/10.1016/j.bbamcr.2016.09.012

6. Капля А.А., Сорокина Л.В., Хижняк С.В. Перепрограммирование энергетического метаболизма митохондрий в злокачественных новообразованиях. Ukr. Biochem.J. 2015; 87(6): 19–35. https://doi.org/10.15407/ubj87.06.019

7. Zong WX, Rabinowitz JD, White E. Mitochondria and Cancer. Mol Cell. 2016 Mar 3; 61(5): 667–676. https://doi.org/10.1016/j.molcel.2016.02.011

8. Badrinath N, Yoo SY. Mitochondria in cancer: in the aspects of tumorigenesis and targeted therapy. Carcinogenesis. 2018 Dec 31; 39(12): 1419–1430. https://doi.org/10.1093/carcin/bgy148

9. Куликов В.А., Беляева Л. Е. О биоэнергетике опухолевой клетки. Вестник ВГМУ. 2015; 14(6): 5–14.

10. Srinivasan S, Guha M, Kashina A, Avadhani NG. Mitochondrial dysfunction and mitochondrial dynamics-The cancer connection Biochim. Biophys. 2017; 1858(8): 602–614. https://doi.org/10.1016/j.bbabio.2017.01.004

11. Brandon M, Baldi P, Wallance DC. Mitochondrial mutations in cancer. Oncogene. 2006; 25(34): 4647–4662. https://doi.org/10.1038/sj.onc.1209607

12. Wallace DC. The mitochondrial genome in human adaptive radiation and disease: on the road to therapeutics and performance enhancement. Gene. 2005 Jul 18; 354: 169–80. https://doi.org/10.1016/j.gene.2005.05.001

13. Wallace DC. Mitochondrial DNA mutations in disease and aging. Environ Mol Mutagen. 2010 Jun; 51(5): 440–50. https://doi.org/10.1002/em.20586

14. Wallace DC. Mitochondria and cancer. Nat Rev Cancer. 2012 Oct; 12(10): 685–698. https://doi.org/10.1038/nrc3365

15. Wernick RI, Estes S, Howe DK, Denver DR. Paths of Heritable Mitochondrial DNA Mutation and Heteroplasmy in Reference and gas 1 Strains of Caenorhabditis elegans. Front Genet. 2016; 7: 51. https://doi.org/10.3389/fgene.2016.00051

16. Gustafsson CM, Falkenberg M, Larsson NG. Maintenance and Expression of Mammalian Mitochondrial DNA. Annu Rev Biochem. 2016 Jun 2; 85: 133–160. https://doi.org/10.1146/annurev-biochem-060815–014402

17. Guerra F, Arbini AA, Moro L. Mitochondria and cancer chemoresistance. Biochim Biophys Acta Bioenerg. 2017; 1858(8): 686–699. https://doi.org/10.1016/j.bbabio.2017.01.012

18. Ostojić J, Panozzo C, Bourand-Plantefol A, Herbert CJ, Dujardin G, Bonnefoy N. Ribosome recycling defects modify the balance between the synthesis and assembly of specific subunits of the oxidative phosphorylation complexes in yeast mitochondria. Nucleic Acids Res. 2016; 44(12): 5785–5797. https://doi.org/10.1093/nar/gkw490

19. Srinivasan S, Guha M, Kashina A, Avadhani NG. Mitochondrial dysfunction and mitochondrial dynamics-The cancer connection Biochim. Biophys. 2017; 1858(8): 602–614. https://doi.org/10.1016/j.bbabio.2017.01.004

20. Guerra F, Guaragnella, N, Arbini AA, Bucci C, Giannattasiom S, Moro L. Mitochondrial Dysfunction: A Novel Potential Driver of Epithelial-to-Mesenchymal Transition in Cancer. Frontiers in oncology. 2017 Dec 1; 7: 295. https://doi.org/10.3389/fonc.2017.00295

21. Yeung KT, Yang J. Epithelial-mesenchymal transition in tumor metastasis. Mol Oncol. 2017; 11(1): 28–39. https://doi.org/10.1002/1878–0261.12017

22. Shibue T, Weinberg RA. EMT, CSCs, and drug resistance: the mechanistic link and clinical implications. Nat Rev Clin Oncol. 2017; 14(10): 611–629. https://doi.org/10.1038/nrclinonc.2

23. Payen VL, Porporato PE, Baselet B, Sonveaux P. Metabolic changes associated with tumor metastasis, part 1: tumor pH, glycolysis and the pentose phosphate pathway. Cell Mol Life Sci. 2016; 73(7): 1333–1348. https://doi.org/10.1007/s00018–015–2098–5

24. Porporato PE, Payen VL, Baselet B, Sonveaux P. Metabolic changes associated with tumor metastasis, part 2: mitochondria, lipid and amino acid metabolism. Cell Mol Life Sci. 2016; 73(7): 1349–1363. https://doi.org/10.1007/s00018–015–2100–2

25. Sciacovelli M, Goncalves E, Johnson TI, Zecchini VR, da Costa AS, Gaude E, et al. Fumarate is an epigenetic modifier that elicits epithelial-to-mesenchymal transition. Nature. 2016; 537(7621): 544–547. https://doi.org/10.1038/nature19353

26. Girolimetti G, Guerra F, Iommarini L, Kurelac I, Vergara D, Maffia M, et al. Platinum-induced mitochondrial DNA mutations confer lower sensitivity to paclitaxel by impairing tubulin cytoskeletal organization. Hum Mol Genet. 2017; 26(15): 2961–2974. https://doi.org/10.1093/hmg/ddx186

27. Schmidt LS, Linehan WM. Hereditary leiomyomatosis and renal cell carcinoma. Int J Nephrol Renovasc Dis. 2014; 7: 253–260. https://doi.org/10.2147/IJNRD.S42097

28. Sciacovelli M, Frezza C. Oncometabolites: unconventional triggers of oncogenic signalling cascades. Free Radic Biol Med. 2016; 100: 175–181. https://doi.org/10.1016/j.freeradbiomed.2016.04.025

29. Cairns RA, Mak TW. Oncogenic isocitrate dehydrogenase mutations: mechanisms, models, and clinical opportunities. Cancer Discov. 2013; 3(7): 730–741. https://doi.org/10.1158/2159–8290.CD-13–0083

30. Colvin H, Nishida N, Konno M, Haraguchi N, Takahashi H, Nishimura J, et al. Oncometabolite D 2 hydroxyglurate directly induces epithelial-mesenchymal transition and is associated with distant metastasis in colorectal cancer. Sci Rep. 2016; 6: 36289. https://doi.org/10.1038/srep36289

31. Bardella C, Pollard PJ, Tomlinson I. SDH mutations in cancer. Biochim Biophys Acta. 2011; 1807(11): 1432–1443. https://doi.org/10.1016/j.bbabio.2011.07.003

32. Letouze E, Martinelli C, Loriot C, Burnichon N, Abermil N, Ottolenghi C, et al. SDH mutations establish a hypermethylator phenotype in paraganglioma. Cancer Cell. 2013;23(6):739–752. https://doi.org/10.1016/j.ccr.2013.04.018

33. Loriot C, Domingues M, Berger A, Menara M, Ruel M, Morin A, et al. Deciphering the molecular basis of invasiveness in Sdhb-deficient cells. Oncotarget. 2015; 6(32): 32955–32965. https://doi.org/10.18632/oncotarget.5106

34. Aspuria PP, Lunt SY, Varemo L, Vergnes L, Gozo M, Beach JA, et al. Succinate dehydrogenase inhibition leads to epithelial-mesenchymal transition and reprogrammed carbon metabolism. Cancer Metab. 2014; 2: 21. https://doi.org/10.1186/2049–3002–2–21

35. Wang Z, Guo W, Kuang X, Hou S, Liu H. Nanopreparations for mitochondria targeting drug delivery system: current strategies and future prospective. Asian J Pharm Sci. 2017; 12: 498–508. https://doi.org/10.1016/j.ajps.2017.05.006

36. Gaude E, Frezza C. Tissue-specific and convergent metabolic transformation of cancer correlates with metastatic potential and patient survival. Nat Commun. 2016; 7: 13041. https://doi.org/10.1038/ncomms130

37. Stein A, Sia EA. Mitochondrial DNA repair and damage tolerance. Front Biosci (Landmark Ed). 2017; 22: 920–943. https://doi.org/10.2741/4525

38. Vergara D, Stanca E, Guerra F, Priore P, Gaballo A, Franck J, et al. beta-Catenin knockdown affects mitochondrial biogenesis and lipid metabolism in breast cancer cells. Front Physiol. 2017; 8: 544. https://doi.org/10.3389/fphys.2017.00544

39. Weerts MJ, Sieuwerts AM, Smid M, Look MP, Foekens JA, Sleijfer S, et al. Mitochondrial DNA content in breast cancer: impact on in vitro and in vivo phenotype and patient prognosis. Oncotarget. 2016; 7(20): 29166–29176. https://doi.org/10.18632/oncotarget.8688

40. Eisenberg-Bord M, Schuldiner M. Mitochatting — if only we could be a fly on the cell wall. Biochim Biophys Acta. 2017; 1864(9): 1469–1480. https://doi.org/10.1016/j.bbamcr.2017.04.012

41. Picard M, McManus MJ. Mitochondrial Signaling and Neurodegeneration. In: Reeve A, Simcox E, Duchen M, Turnbull D. (eds) Mitochondrial Dysfunction in Neurodegenerative Disorders. Springer, Cham. 2016; 107–137 p. https://doi.org/10.1007/978–3–319–28637–2_5

42. Quiros PM, Mottis A, Auwerx J. Mitonuclear communication in homeostasis and stress. Nat Rev Mol Cell Biol. 2016; 17(4): 213–226. https://doi.org/10.1038/nrm.2016.23

43. Bustos G, Cruz P, Lovy A, Cárdenas C. Endoplasmic Reticulum-Mitochondria Calcium Communication and the Regulation of Mitochondrial Metabolism in Cancer: A Novel Potential Target.Front Oncol. 2017; 7: 199. https://doi.org/10.3389/fonc.2017.0019

44. Naito A, Cook CC, Mizumachi T, Wang M, Xie CH, Evans TT, et al. Progressive tumor features accompany epithelial-mesenchymal transition induced in mitochondrial DNA-depleted cells. Cancer Sci. 2008; 99(8): 1584–1588. https://doi.org/10.1111/j.1349–7006.2008.00879.x

45. Yi EY, Park SY, Jung SY, Jang WJ, Kim YJ. Mitochondrial dysfunction induces EMT through the TGF-beta/Smad/Snail signaling pathway in Hep3B hepatocellular carcinoma cells. Int J Oncol. 2015; 47(5): 1845–1853. https://doi.org/10.3892/ijo.2015.3154

46. Jiang HL, Sun HF, Gao SP, Li LD, Huang S, Hu X, et al. SSBP1 suppresses TGFbeta-driven epithelial-to-mesenchymal transition and metastasis in triple-negative breast cancer by regulating mitochondrial retrograde signaling. Cancer Res. 2016; 76(4): 952–964. https://doi.org/10.1158/0008–5472.CAN-15–16.

47. Guaragnella N, Giannattasio S, Moro L. Mitochondrial dysfunction in cancer chemoresistance. Biochem Pharmacol. 2014; 92(1): 62–72. https://doi.org/10.1016/j.bcp.2014.07.027

48. Momekova D, Ugrinova I, Slavkova M, Momekov G, Grancharov G, Gancheva V, et al. Superior proapoptotic activity of curcumin-loaded mixed block copolymer micelles with mitochondrial targeting properties. Biomaterials Science. 2018 Nov 20; 6(12): 3309–3317. https://doi.org/10.1039/C8BM00644J

49. Bi R, Logan I, Yao Y G. Leber Hereditary Optic Neuropathy: A Mitochondrial Disease Unique in Many Ways. Handb Exp Pharmacol. 2017; 240: 309–336. https://doi.org/10.1007/164_2016_1

50. Battogtokh G, Choi YS, Kang DS, Park SJ, Shim MS, Huh KM, et al. Mitochondria-targeting drug conjugates for cytotoxic, anti-oxidizing and sensing purposes: current strategies and future perspectives. Acta Pharm Sin B. 2018 Oct; 8(6): 862–880. https://doi.org/10.1016/j.apsb.2018.05.006

51. D’Aquila P, Bellizzi D, Passarino G. Mitochondria in health, 1aging and diseases: the epigenetic perspective, Biogerontology. 2015; 16(5): 569–585. https://doi.org/10.1007/s10522–015–9562–3

52. Palmfeldt J, Bross P. Proteomics of human mitochondria, Mitochondrion. 2017; 33: 2–14. https://doi.org/10.1016/j.mito.2016.07.006

53. Tyanova S, Albrechtsen R, Kronqvist P, Cox J, Mann M, Geiger T. Proteomic maps of breast cancer subtypes. Nat Commun. 2016 Jan 4; 7: 10259. https://doi.org/10.1038/ncomms10259

54. Monteith GR, Prevarskaya N, Roberts-Thomson SJ. The calcium–cancer signallingnexus.Nat Rev Cancer. 2017; 17(6): 367–380. https://doi.org/10.1038/nrc.2017.18

55. Leanza L, Romio M, Becker KA, Azzolini M, Trentin L, Managò A, et al. Direct Pharmacological Targeting of a Mitochondrial Ion Channel Selectively Kills Tumor Cells In Vivo. Cancer Cell. 2017 10; 31(4): 516–531.e10. https://doi.org/10.1016/j.ccell.2017.03.003

56. Birsoy K, Wang T, Chen WW, Freinkman E, et al. An Essential Role of the Mitochondrial Electron Transport Chain in Cell Proliferation Is to Enable Aspartate Synthesis. Cell. 2015; 162(3): 540–551. https://doi.org/10.1016/j.cell.2015.07.016

57. Wang Z, Guo W, Kuang X, Hou S, Liu H. Nanopreparations for mitochondria targeting drug delivery system: current strategies and future prospective. Asian J Pharm Sci. 2017; 12: 498–508. https://doi.org/10.1016/j.ajps.2017.05.006

58. Kim KY, Jin H, Park J, Jung SH, Lee JH, Park H, et al. Mitochondria-targeting self-assembled nanoparticles derived from triphenylphosphonium-conjugated cyanostilbene enable site-specific imaging and anticancer drug delivery. Nano Res. 2018 Feb 1; 11(2): 1082–1098. https://doi.org/10.1007/s12274–017–1728–7

Системное хроническое воспаление и митохондриальная дисфункция в генезе синдрома поликистозных яичников

Цель исследования. Провести систематический анализ современной литературы об участии хронического системного воспаления и митохондриальной дисфункции в этиологии и патогенезе синдрома поликистозных яичников и формирования осложнений заболевания.

Материал и методы. В обзор включены статьи зарубежных и отечественных авторов по данной теме, опубликованные в журналах системы Pubmed за последние 10 лет.

Результаты. Суммированы известные на сегодняшний день пути участия нарушений митохондриальной функции и хронического воспаления на системном и локальном уровне в развитии СПКЯ. Описаны возможные пути потенциирования оксидативного стресса и системного воспаления при СПКЯ, в том числе при повышении в крови концентрации свободных жирных кислот и конечных продуктов гликирования, гипергликемии, гиперлептинемии, накопления повреждений митохондрий и митохондриальной ДНК.

Заключение. Накапливаются доказательства наличия положительной обратной связи процессов системного воспаления и митохондриальной дисфункции в генезе СПКЯ.

1. Deligeoroglou E., Vrachnis N., Athanasopoulos N., Iliodromiti Z., Sifakis S., Iliodromiti S. et al. Mediators of chronic inflammation in polycystic ovarian syndrome. Gynecol. Endocrinol. 2012; 28(12): 974-8. doi: 10.3109/09513590.2012.683082.

2. El Hayek S., Bitar L., Hamdar L.H., Mirza F.G., Daoud G. Poly cystic ovarian syndrome: an updated overview. Front. Physiol. 2016; 7: 124. doi: 10.3389/fphys.2016.00124.

3. Rojas J., Chávez M., Olivar L., Rojas M., Morillo J., Mejías J. Polycystic ovary syndrome, insulin resistance, and obesity: navigating the patophysiologic labyrinth. Int. J. Reprod. Med. 2014; 2014: 1-17. doi: 10.1155/2014/719050.

4. Sousa S.M., Norman R.J. Metabolic syndrome, diet and exercise. Best Pract. Res. Clin. Obstet. Gynaecol. 2016 Feb 10. pii: S1521-6934(16)00007-9. doi: 10.1016/j.bpobgyn.2016.01.006.

5. Goodman N.F., Cobin R.H., Futterweit W., Glueck J.S., Legro R.S., Carmina E. American association of clinical endocrinologists, american college of endocrinology, and androgen excess and pcos society disease state clinical review: guide to the best practices in the evaluation and treatment of polycystic ovary syndrome- part 1. Endocr. Pract. 2015; 21(11): 1291-300. doi: 10.4158/EP15748.DSC.

6. Zuo T., Zhu M., Xu W. Roles of oxidative stress in polycystic ovary syndrome and cancers. Oxid. Med. Cell. Longev. 2016; 2016: 8589318. doi: 10.1155/2016/8589318.

7. Oleszczak B., Szablewski L., Pliszka M., Głuszak O., Stopińska-Głuszak U. Transport of deoxy-d-glucose into lymphocytes of patients with polycystic ovary syndrome. Endocrine. 2014; 47(2): 618-24. doi: 10.1007/s12020-014-0174-5.

8. Diamanti-Kandarakis E., Dunaif A. Insulin resistance and the polycystic ovary syndrome revisited: an update on mechanisms and implications. Endocr. Rev. 2012; 33(6): 981-1030.

9. Garg D., Zaher M. Advanced glycation end products: link between diet and ovulatory dysfunction in PCOS? Nutrients. 2015; 7(12): 10129-44.

10. Dumesic D.A., Oberfield S.E., Stener-Victorin E., Marshall J.C., Laven J.S., Legro R.S. Scientific statement on the diagnostic criteria, epidemiology, pathophysiology, and molecular genetics of polycystic ovary syndrome. Endocr. Rev. 2015; 36(5): 487-525. doi: 10.1210/er.2015-1018.

11. Turan V., Sezer E.D., Zeybek B., Sendag F. Infertility and the presence of insulin resistance are associated with increased oxidative stress in young, non-obese Turkish women with polycystic ovary syndrome. J. Pediatr. Adolesc. Gynecol. 2015; 28(2): 119-23. doi: 10.1016/j.jpag.2014.05.003.

12. Murri M., Luque-Ramírez M., Insenser M., Ojeda-Ojeda M., Escobar-Morreale H.F. Circulating markers of oxidative stress and polycystic ovary syndrome (PCOS): a systemic review and meta-analysis. Hum. Reprod. Update. 2013; 19(3): 268-88. doi: 10.1093/humupd/dms059.

13. Repaci A., Gambineri A., Pasquali R. The role of low-grade inflammation in the polycystic ovary syndrome. Mol. Cell. Endocrinol. 2011; 335(1): 30-41. doi: 10.1016/j.mce.2010.08.002.

14. Sathyapalan T., Atkin S.L. Mediators of inflammation in polycystic ovary syndrome in relation to adiposity. Mediators Inflamm. 2010; 2010: 758656. doi: 10.1155/2010/758656.

15. González F. Inflammation in polycystic ovary syndrome: underpinning of insulin resistance and ovarian dysfunction. Steroids. 2012; 77(4): 300-5. doi: 10.1016/j.steroids.2011.12.003.

16. Fulghesu A.M., Sanna F., Uda S., Magnini R., Portoghese E., Batetta B. Il-6 serum levels and production is related to an altered immune response in polycystic ovary syndrome girls with insulin resistance. Mediators Inflamm. 2011; 2011: 389317. doi: 10.1155/2011/389317.

17. Duleba A.J., Dokras A. Is PCOS an inflammatory process? Fertil. Steril. 2012; 97(1): 7-12.

18. Yang Y., Qiao J., Li R., Li M.Z. Is interleukin-18 associated with polycystic ovary syndrome? Reprod. Biol. Endocrinol. 2011; 9: 7-18. doi: 10.1186/1477-7827-9-7.

19. Tao T., Li S., Zhao A., Zhang Y., Liu W. Expression of the CD11c gene in subcutaneous adipose tissue is associated with cytokine level and insulin resistance in women with polycystic ovary syndrome. Eur. J. Endocrinol. 2012; 167(5): 705-13. doi: 10.1530/EJE-12-0340.

20. Escobar-Morreale H.F., Luque-Ramírez M., González F. Circulating inflammatory markers in polycystic ovary syndrome: a systematic review and meta-analysis. Fertil. Steril. 2011; 95(3): 1048-58. doi: 10.1016/j.fertnstert.2010.11.036.

21. Lee H., Oh J.Y., Sung Y.A. Adipokines, insulin-like growth factor binding protein-3 levels, and insulin sensitivity in women with polycystic ovary syndrome. Korean J. Intern. Med. 2013; 28(4): 456-63. doi: 10.3904/kjim.2013.28.4.456.

22. Мадянов И.В., Мадянова Т.С. Синдром поликистозных яичников у девочек-подростков: клинико-метаболические особенности и перспективы применения метформина. Практическая медицина. 2010; 43(4): 86-9.

23. Victor V.M., Rocha M., Bañuls C., Alvarez A., de Pablo C., Sanchez-Serrano M. et al. Induction of oxidative stress and human leukocyte/endothelial cell interactions in polycystic ovary syndrome patients with insulin resistance. J. Clin. Endocrinol. Metab. 2011; 96(10): 3115-22. doi: 10.1210/jc.2011-0651.

24. González F., Sia C.L., Shepard M.K., Rote N.S., Minium J. Hyperglycemia-induced oxidative stress is independent of excess abdominal adiposity in normal-weight women with polycystic ovary syndrome. Hum. Reprod. 2012; 27(12): 3560-8. doi: 10.1093/humrep/des320.

25. Conway G., Dewailly D., Diamanti-Kandarakis E., Escobar-Morreale H.F., Franks S., Gambineri A. et al. The polycystic ovary syndrome: a position statement from the European Society of Endocrinology. Eur. J. Endocrinol. 2014; 171: 1-29. doi: 10.1530/EJE-14-0253.

26. Niu Z., Lin N., Gu R., Sun Y., Feng Y. Associations between insulin resistance, free fatty acids, and oocyte quality in polycystic ovary syndrome during in vitro fertilization. J. Clin. Endocrinol. Metab. 2014; 99(11): 2269-76. doi: 10.1210/jc.2013-3942.

27. González F. Nutrient-induced inflammation in polycystic ovary syndrome: role in the development of metabolic aberration and ovarian dysfunction. Semin. Reprod. Med. 2015; 33(4): 276-86. doi: 10.1055/s-0035-1554918.

28. Boden G. Obesity, insulin resistance and free fatty acids. Curr. Opin. Endocrinol. Diabetes Obes. 2011; 18(2): 139-43.

29. Acosta-Martínez M. PI3K: an attractive candidate for the central integration of metabolism and reproduction. Front. Endocrinol. (Lausanne). 2012; 2: 110-50.

30. Martin S.S., Qasim A., Reilly M.P. Leptin resistance: a possible interface of inflammation and metabolism in obesity-related cardiovascular disease. J. Am. Coll. Cardiol. 2008; 52(15): 1201-10. doi: 10.1016/j.jacc.2008.05.060.

31. Pertynska-Marczewska M., Diamanti-Kandarakis E., Zhang J., Merhi Z. Advanced glycation end products: a link between metabolic and endothelial dysfunction in polycystic ovary syndrome? Metabolism. 2015; 64(11): 1564-73. doi: 10.1016/j.metabol.2015.08.010.

32. Isoda K., Folco E., Marwali M.R., Ohsuzu F., Libby P. Glycated LDL increases monocyte CC chemokine receptor 2 expression and monocyte chemoattractant protein-1-mediated chemotaxis. Atherosclerosis. 2008; 198(2): 307-12. doi: 10.1016/j.atherosclerosis.2007.10.035.

33. Diamanti-Kandarakis E., Piperi C., Spina J., Argyrakopoulou G., Papanastasiou L., Bergiele A. et al. Polycystic ovary syndrome: the influence of environmental and genetic factors. Hormones. 2006; 5(1): 17-34.

34. Thorne J.T., Segal T.R., Chang S., Jorge S., Segars J.H., Leppert P.C. Dynamic reciprocity between cells and their microenvironment in reproduction. Biol. Reprod. 2015; 92(1): 25. doi: 10.1095/biolreprod.114.121368.

35. Wirth C., Brandt U., Hunte C., Zickermann V. Structure and function of mitochondrial complex I. Biochim. Biophys. Acta. 2016; 1857(7): 902-14. doi: 10.1016/j.bbabio.2016.02.013.

36. Martínez-Reyes I., Diebold L.P., Kong H., Schieber M., Huang H., Hensley C.T. et al. TCA cycle and mitochondrial membrane potential are necessary for diverse biological functions. Mol. Cell. 2016; 61(2): 199-209. doi: 10.1016/j.molcel.2015.12.002.

37. Zong W.X., Rabinowitz J.D., White E. Mitochondria and cancer. Mol. Cell. 2016; 61(5): 667-76. doi: 10.1016/j.molcel.2016.02.011.

38. Zorov D.B., Juhaszova M., Sollott S.J. Mitochondrial reactive oxygen species (ROS) and ROS-induced ROS release. Physiol. Rev. 2014; 94(3): 909-50. doi: 10.1152/physrev.00026.2013.

39. Nunnari J., Suomalainen A. Mitochondria: in sickness and in health. Cell. 2012; 148(6): 1145-59. doi: 10.1016/j.cell.2012.02.035.

40. Yun J., Finkel T. Mitohormesis. Cell Metab. 2014; 19(5): 757-66. doi: 10.1016/j.cmet.2014.01.011.

41. Kim J., Wei Y., Sowers J.R. Role of mitochondrial dysfunction in insulin resistance. Circ. Res. 2008; 102(4): 401-14. doi: 10.1161/CIRCRESAHA.107.165472.

42. Zhao Y., Fu L., Li R., Wang L.N., Yang Y., Liu N.N. et al. Metabolic profiles characterizing different phenotypes of polycystic ovary syndrome: plasma metabolomics analysis. BMC Med. 2012; 10: 153-63. doi: 10.1186/1741-7015-10-153.

43. Kaludercic N., Giorgio V. The dual function of reactive oxygen/nitrogen species in bioenergetics and cell death: the role of ATP synthase. Oxid. Med. Cell. Longev. 2016; 2016: 3869610. doi: 10.1155/2016/3869610.

44. Ding Y., Zhuo G., Zhang C. The mitochondrial tRNALeu(UUR) A3302G mutation may be associated with insulin resistance in woman with polycystic ovary syndrome. Reprod. Sci. 2016; 23(2): 228-33. doi: 10.1177/1933719115602777.

45. Wenceslau C.F., McCarthy C.G., Szasz T., Spitler K., Goulopoulou S., Webb R.C.; Working Group on DAMPs in Cardiovascular Disease. Mitochondrial damage-associated molecular patterns and vascular function. Eur. Heart J. 2014; 35(18): 1172-7. doi:10.1093/eurheartj/ehu047.

46. Walker M.A., Volpi S., Sims K.B., Walter J.E., Traggiai E. Powering the immune system: mitochondria in immune function and deficiency. J. Immunol. Res. 2014; 2014: 164309. doi: 10.1155/2014/164309.

47. Konopka A.R., Asante A., Lanza I.R., Robinson M.M., Johnson M.L., Dalla Man C. et al. Defects in mitochondrial efficiency and h3O2 emissions in obese women are restored to a lean phenotype with aerobic exercise training. Diabetes. 2015; 64(6): 2104-15. doi: 10.2337/db14-1701.

Поступила 29.08.2016

Принята в печать 02.09.2016

Хащенко Елена Петровна, аспирант 2-го гинекологического отделения (гинекологии детского и юношеского возраста) ФГБУ НЦАГиП им. академика В.И. Кулакова Минздрава России. Адрес: 117997, Россия, Москва, ул. Академика Опарина, д. 4. Телефон: 8 (495) 438-85-42. Е-mail:

Цвиркун Дарья Викторовна, к.б.н., ст.н.с. лаборатории митохондриальной медицины ФГБУ НЦАГиП им. академика В.И. Кулакова Минздрава России. Адрес: 117997, Россия, Москва, ул. Академика Опарина, д. 4. Телефон: 8 (495) 438-76-33 (доб. 1472). E-mail:

Для цитирования: Хащенко Е.П., Цвиркун Д.В. Системное хроническое воспаление и митохондриальная дисфункция в генезе синдрома поликистозных яичников. Акушерство и гинекология. 2016; 12: 41-6.
http://dx.doi.org/10.18565/aig.2016.12.41-6

SENS-диагностика. Биомаркеры митохондриальной дисфункции и окислительного стресса

Этим обзором мы начинаем серию статей по описанию потенциальных биомаркеров для диагностической панели старения SENS.

Концепция SENS (Strategies for Engineered Negligible Senescence, стратегии достижения пренебрежимого старения инженерными методами) была предложена британским геронтологом Обри ди Грей. Идея концепции – это необходимость развития и применения технологий для борьбы со старением и возраст-зависимыми заболеваниями для «починки» накапливающихся повреждений в организме. Цель нашего обзора потенциальных биомаркеров состоит в том, чтобы создать панель SENS-диагностики старения.

Зачем нужна диагностика SENS?

  1. Дать возможность человеку объективно оценить что происходит с его организмом в процессе старения с точки зрения SENS.
  2. Увидеть индивидуальные риски тех или иных типов повреждений связанных со старением.
  3. Оценить эффективность разрабатываемых методов омоложения. Увидеть, как как физическая активность, диеты, режим дня, пищевые добавки, лекарственные препараты действует с точки зрения стратегии замедления старения.
  4. Сравнить с другими диагностическими панелями старения, и дополнить их развитие.
  5. Предоставить данные об изменениях параметров для научных исследований.
  6. Принять решение о финансировании научных исследований исходя из наиболее интересных и чувствительных для себя рисков.
  7. Найти единомышленников для решения биологических задач, возникших в результате понимания собственного состояния организма с точки зрения SENS.

Концепция SENS включает в себя 7 разделов. Первым пунктом для рассмотрения мы выбрали дисфункцию митохондрий (или MitoSENS).


Митохондрии – это крошечные органеллы эукариотических организмов (за исключением лямблий населяющих кишечник шиншилл), в которых вырабатывается энергия для всех биохимических процессов. Согласно самой популярной версии, митохондрии когда-то давно были самостоятельными единицами жизни, пурпурными фотосинтезирующими бактериями, но в процессе эволюции были поглощены древними микроорганизмами, археями, и стали вырабатывать для них энергию. В каждой клетке может содержаться более тысячи митохондрий, так, например, клетки мышц сердца имеют до 5000 митохондрий. Молекулярные моторы, АТФ-синтазы, встроенные во внутреннюю мембрану митохондрий, под воздействием потока протонов вращаются и синтезируют основной источник энергии – аденозинтрифосфорную кислоту, АТФ. Подсчитано, что организм взрослого человека синтезирует и расходует около 40 кг АТФ в сутки.

Митохондрии, в отличие от других органелл, имеют свои собственные 2-10 копий ДНК, мтДНК. В процессе производства энергии митохондрии генерируют токсичные «отходы» — активные формы кислорода (АФК), которые могут повреждать как прочие молекулы, так и различные клеточные структуры и, прежде всего, сами митохондрии, что может вызывать мутации в митохондриальной ДНК и негативно сказываться на общем энергетическом балансе организма. Так, имеющие делеции (выпадения участков) мтДНК способны быстро размножаться и заполнять собой клеточное пространство, вызывая саркопению и нейродегенерацию. «Испорченные» митохондрии начинают производить ещё большие количества АФК, приводя к увеличению окислительного стресса, который, в свою очередь, может стать причиной, развития различных патологий, преждевременного старения и гибели клетки.

Интересный факт, связанный с окислительным стрессом. Обнаружено, что существует четкая корреляция между уровнем насыщенности жирных кислот в мембранах и продолжительностью жизни животных: чем больше в мембране ненасыщенных кислот, тем меньше продолжительность жизни животного. Испанские биологи проследили такую последовательность, показывающую увеличение срока жизни при одновременном уменьшении содержания в мембранах докозагексаеновой ω-3 жирной кислоты: мышь → крыса → кролик → человек → кит [1].

Такую закономерность легко объяснить, ведь ненасыщенные жирные кислоты являются главными «жертвами» перекисного окисления липидов. Таким образом, липидный состав мембран клеток животных, которым свойственна более длительная продолжительность жизни, демонстрирует «золотую» середину: малое количество совсем ненасыщенных докозагексаеновых 22:6 ω-3 жирных кислот и преобладание менее ненасыщенных линоленовых 18:03 ω-3 жирных кислот, что создает тот самый баланс, обеспечивающий как защиту от воздействия АФК, так и сохранение необходимой текучести мембраны.

Кроме липидного состава мембран клеток животных, доля более термодинамически стабильных гуанина и цитозина среди всех остатков нуклеотидов мтДНК так же коррелирует с максимальной видовой продолжительностью жизни млекопитающих [2].

Создатели концепции SENS видят решение проблемы дисфункции митохондрий в переносе «резервных копий» митохондриальных генов в ядро, где они не могут быть повреждены АФК, генерируемыми в митохондриях. Таким образом, даже если исходные гены в мтДНК будут повреждены, резервные копии в ядерной ДНК будут иметь возможность поставлять белки, необходимые для поддержания нормальной работы по производству энергии. Этот подход называется аллотопической экспрессией белков. мтДНК человека содержит всего 37 генов из которых всего 13 кодируют белки, необходимые митохондриям, остальные (более 1000) белков координирующих работу митохондрий закодированы в ядерной ДНК. По мнению авторов SENS, перенос основных митохондриальных генов в ядро был осуществлён эволюцией именно с этой целью – уберечь их от повреждающего действия АФК.

Идея авторов SENS об эволюционном переносе ДНК митохондрий в ядерную с целью обезопасить мтДНК от вредных факторов и, таким образом, продлить жизнь, находит подтверждение в исследованиях, посвящённых анализу NUMT (nuclear mitochondrial DNA segment). Термином NUMT обозначаются фрагменты мтДНК, перенесённые в ядерную ДНК. Проведённый сравнительный анализ 17 видов животных с полностью секвенированными митохондриальными и ядерными геномами показал значительную положительную корреляцию между продолжительностью жизни и количеством последовательностей NUMT [3]. Теперь осталось найти инженерное решение по переносу резервных копий оставшихся 13 генов мтДНК.

Но существуют и альтернативные подходы к улучшению функции митохондрий. И один из них – трансплантация митохондрий извне. Описано успешное «подселение» чужеродных митохондрий в опытах с животными. Так, перенос митохондрий использовался в животных моделях при остром повреждении легких, сердечно-сосудистых болезнях и болезни Паркинсона. Подсаживание митохондрий может быть осуществлено несколькими способами: во-первых, прямое введение изолированных митохондрий (локальное введение), когда изолированные митохондрии вводят непосредственно в клетки поврежденного участка; во-вторых, системное введение, когда митохондрии вводят в общий кровоток, а затем они сами распределяются по организму. Полученные результаты свидетельствуют о перспективах трансплантации митохондрий при лечении ряда болезней [4].

Вместе с этим было бы логичным найти потенциальные биомаркеры для определения окислительного стресса, вызванного митохондриальной дисфункцией.

Окислительный стресс представляет собой дисбаланс между оксидантами (активными формами кислорода) и антиоксидантной защитой в организме в сторону окислителей. В клетках оксиданты активно взаимодействуют с биомолекулами (фосфолипидами, белками и нуклеиновыми кислотами). В результате эти биомолекулы необратимо повреждаются, что приводит к клеточной дисфункции и, как следствие, различным патологиям в организме и гибели клеток. Одна из наиболее популярных теорий старения, свободнорадикальная, предложенная Д. Харманом в 1950-х годах, видит в этом основной механизм старения.

Молекулы, образующиеся при окислении, могут служить в качестве биомаркеров. Их анализ используется для количественного определения окислительного стресса у людей. Высокие концентрации биомаркеров окислительного стресса определяются не только при возрастных или дегенеративных заболеваниях, таких как болезнь Альцгеймера, гипертония, диабет второго типа или несколько видов рака, но и при хронической обструктивной болезни легких, курении и проживании в неблагополучных с точки зрения экологии районах.

Одним из самых значимых биомаркеров окислительного стресса является 8-iso prostaglandin F2α (8-изопростан). 8-изопростан образуется при неферментативном окислении фосфолипидов клеточных биомембран, а именно арахидоновой кислоты. Это простагландин-подобное вещество вызывает сужение кровеносных сосудов и бронхов, снижает кровоток в почках, влияет на агрегацию тромбоцитов и, таким образом, участвует в патологии нескольких заболеваний. Нормальными показателями 8-изопростана у здоровых людей считается 11±4 пг/мл [5].

Также признанным биомаркером окисления липидов выступает малоновый диальдегид (МДА), который образуется при перекисном окислении липидов свободными радикалами и разрыве молекул полинасыщенных жирных кислот. Повышенная концентрация МДА в сыворотке крови служит маркером не только окислительного стресса, но и степени эндогенной интоксикации. Поэтому повышение концентрации МДА в плазме наблюдается у курильщиков, а также у людей, злоупотребляющих спиртными напитками. МДА образует Шиффовы основания с аминогруппами белка, в результате чего возникают нерастворимые липид-белковые комплексы (пигменты изнашивания или липофусцины). МДА определяют в образцах многих биологических жидкостей: сыворотке, плазме, моче, конденсате выдыхаемого воздуха. Концентрация МДА в сыворотке крови у здоровых людей (в норме) меньше 1 мкмоль/л [6].

При окислении аминокислот, входящих в состав белков, образуются ещё ряд потенциальных биомаркеров окислительного стресса: o-тирозин, 3-хлортирозин и 3-нитротирозин.

Физиологически в организме эндогенный тирозин образуется путем ферментативного окисления фенилаланина фенилаланингидроксилазой. o-тирозин (o-Tyr) и м-тирозин (m-Tyr) образуются при окислении активными формами кислорода фенилаланина. o-Tyr и m-Tyr не являются естественными аминокислотами и считаются биомаркерами окислительного стресса. Высокие концентрации o-Tyr и m-Tyr были обнаружены у пациентов с катарактой, а повышенный o-Tyr был найден в плазме крови и моче пациентов с диабетом второго типа. 3-Хлоротирозин (3-ClTyr) образуется в свободнорадикальных процессах, при реакции хлорноватистой кислоты (HClO, производной перекиси водорода) и п-тирозина.

Образование 3-ClTyr играет важную роль в сердечно-сосудистой системе, так как связано с развитием атеросклероза. 3-ClTyr способствует миграции клеток гладкой мускулатуры аорты человека (основного механизма образования сосудистых поражений), и повышенные уровни 3-ClTyr в условиях воспаления могут способствовать сосудистым заболеваниям. 3-нитротирозин (3-Notyr) образуется при окислительном стрессе путём нитрования тирозина агрессивным фагоцитарным белком миелопероксидазой (МПО). Такое нитрование негативно влияет на функцию белка. Более высокие концентрации 3-Notyr были обнаружены в цереброспинальной жидкости пациентов с болезнью Альцгеймера (11,4±5,4 нМ у пациентов и 1,6±0,4 нМ в группе здоровых добровольцев), а также у людей с артритом, атеросклерозом и гипертонией [5].

Также при действии АФК и HClO на белки образуются разнообразные продукты окисления белков (AOPP). Такие белки не выполняют своих функций и могут нанести значительный вред. AOPP продуцируются системой миелопероксидаза-перекись водорода. Более высокие концентрации AOPP были обнаружены в плазме или моче пациентов с острым коронарным синдромом или активным язвенным колитом. Нормальными показателями АОРР у здоровых людей считается уровень в плазме 60–70 нМ [5].

Общеизвестными биомаркерами окисления нуклеиновых кислот выступают 8-гидроксигуанозин (8-OHG) и 8-гидрокси-2′-дезоксигуанозин (8-OHdG). 8-OHdG является основным продуктом окисления ДНК. 8-OHG образуется при окислении РНК. Более высокая концентрация 8-OHdG обнаруживается у пациентов с болезнью Альцгеймера, артритом, атеросклерозом, катарактой, гипертонией, остеопорозом и диабетом второго типа. 8-OHdG также считается потенциальным биомаркером рака, связанного с курением (например, раком легких). 8-OHG можно обнаружить у пациентов с болезнью Альцгеймера, и было показано, что окислительное повреждение РНК выше, чем повреждение ДНК. Концентрации 8-OHdG в крови у здоровых людей составляют 1,09±0,52 нМ, уровни 8-OHG (в спинномозговой жидкости) – 97±32 пМ [5].

Ещё одним биомаркером, определяющим дисфункцию митохондрий и окислительный стресс, является количество копий клеточной мтДНК (существует ещё внеклеточная мтДНК, которая попадает в кровь при распаде клеток и её уровень увеличивается с возрастом). Так, известно, что с возрастом количество клеточной мтДНК снижается, причём у мужчин больше, чем у женщин. Более низкий показатель количества мтДНК также значительно связан с развитием старческой астении (дряхлости, frailty). Количество копий мтДНК также может быть эффективным прогностическим маркером смертности от всех причин, от сердечно-сосудистых, онкологических и респираторных заболеваний [7].

Потенциалом использования в качестве биомаркеров митохондриальной дисфункции и окислительного стресса обладают и эндогенные антиоксиданты: глутатион, цистеин, мочевая кислота и убихинол. При взаимодействии с активными формами кислорода эндогенные антиоксиданты окисляются, но затем снова восстанавливаются при помощи специальных ферментов. Поэтому в организме молекулы антиоксидантов присутствуют в двух формах: восстановленной форме (антиоксидантой) или окисленной (после реакции с оксидантами). При помощи хроматографического метода возможно фиксировать отношение восстановленных и окисленных форм антиоксидантов и таким образом определять степень окислительного стресса [8].

Биомаркеры дисфункции митохондрий и окислительного стресса:

1. 8-изопростан.

2. Малоновый диальдегид

3. O-тирозин, 3-хлортирозин, 3-нитротирозин.

4. Продукты окисления белков (AOPP). 

5. 8-гидроксигуанозин (8-OHG)

6. 8-гидрокси-2′-дезоксигуанозин (8-OHdG).

7. Клеточная мтДНК (её количество и наличие мутированных вариантов с делециями)

8. Эндогенные антиоксиданты (глутатион, цистеин, мочевая кислота, убихинол).

Авторы обзора: Денис Одиноков, Алексей Ржешевский.

Список использованной литературы:

1. Pamplona, R., Portero_Otнn, M., Ruiz, C., Gredilla, R., Herrero, A., and Barja, G. (2000) Double bond content of phospholipids and lipid peroxidation negatively correlate with maximum longevity in the heart of mammals, Mech. Ageing Dev., 112, 169–183.

2. Lehmann G1, Segal E, Muradian KK, Fraifeld VE. Do mitochondrial DNA and metabolic rate complement each other in determination of the mammalian maximum longevity? Rejuvenation Res. 2008 Apr;11(2):409-17.

3. Muradian KK1, Lehmann G, Fraifeld VE. NUMT («new mighty») hypothesis of longevity. Rejuvenation Res. 2010 Apr-Jun;13(2-3):152-5.

4. Gollihue, Jenna L., Samir P. Patel, and Alexander G. Rabchevsky. Mitochondrial transplantation strategies as potential therapeutics for central nervous system trauma. Neural regeneration research23.2 (2018): 194.

5. Kamila Syslová, Adéla Böhmová, Miloš Mikoška, Marek Kuzma, Daniela Pelclová, and Petr Kačer. Multimarker screening of oxidative stress in aging. Oxid Med Cell Longev. 2014;562860. Published online 2014 Jul 16.

6. Яшин А., Яшин Я. Высокоэффективная жидкостная хроматография маркеров окислительного стресса. 2011. Аналитика. №1, 34-43.

7. Foram N. et al. Association of Mitochondrial DNA levels with Frailty and All-Cause Mortality. J Mol Med (Berl). 2015 Feb; 93(2): 177–186.

8. Жлоба А.А,. Субботина Т.Ф., Алексеевская Е.С., Моисеева О.М., Гаврилюк Н.Д., Иртюга О.Б. Метаболические и белковые маркеры дисфункции митохондрий у пациентов с сердечно-сосудистыми заболеваниями Клиническая лабораторная диагностика. 2015; 60 (7): 35–41.

Дисфункция митохондрий и хронические заболевания: лечение натуральными добавками

Integr Med (Encinitas). 2014 Август; 13 (4): 35–43.

Основатель, президент и профессор-исследователь кафедры молекулярной патологии Института молекулярной медицины в Хантингтон-Бич, Калифорния.

Copyright © 2014 InnoVision Professional MediaЭта статья цитируется в других статьях PMC.

Abstract

Потеря функции митохондрий, ключевой органеллы, ответственной за выработку клеточной энергии, может привести к чрезмерной утомляемости и другим симптомам, которые являются обычными жалобами почти при каждом хроническом заболевании.На молекулярном уровне снижение функции митохондрий происходит в результате следующих изменений: (1) потеря поддержания электрического и химического трансмембранного потенциала внутренней митохондриальной мембраны, (2) изменение функции транспорта электронов. цепи, или (3) снижение транспорта критических метаболитов в митохондрии. В свою очередь, эти изменения приводят к снижению эффективности окислительного фосфорилирования и снижению выработки аденозин-5′-трифосфата (АТФ).Некоторые компоненты этой системы требуют регулярной замены, и эту потребность можно облегчить с помощью натуральных добавок. Клинические испытания показали полезность использования пероральных замещающих добавок, таких как l-карнитин, альфа-липоевая кислота (α-липоевая кислота [1,2-дитиолан-3-пентановая кислота]), кофермент Q 10 (CoQ 10). [убихинон]), восстановленный никотинамидадениндинуклеотид (НАДН), мембранные фосфолипиды и другие добавки. Комбинации этих добавок могут значительно снизить утомляемость и другие симптомы, связанные с хроническими заболеваниями, и могут естественным образом восстановить функцию митохондрий даже у длительно длительных пациентов с трудноизлечимой усталостью.

Дисфункция митохондрий, характеризующаяся потерей эффективности цепи переноса электронов и снижением синтеза высокоэнергетических молекул, таких как аденозин-5′-трифосфат (АТФ), является признаком старения и, по сути, всего хронические заболевания.1–4 Эти заболевания включают нейродегенеративные заболевания, такие как болезнь Альцгеймера, болезнь Паркинсона, болезнь Хантингтона, боковой амиотрофический склероз и атаксия Фридрейха1,2,4,5; сердечно-сосудистые заболевания, такие как атеросклероз и другие сердечные и сосудистые заболевания6,7; диабет и метаболический синдром8–10; аутоиммунные заболевания, такие как рассеянный склероз, системная красная волчанка и диабет 1 типа11–14; нейроповеденческие и психические заболевания, такие как расстройства аутистического спектра, шизофрения, биполярные расстройства и расстройства настроения15-19; желудочно-кишечные расстройства20,21; утомляющие болезни, такие как синдром хронической усталости и болезни, вызванные войной в Персидском заливе22–24; заболевания опорно-двигательного аппарата, такие как фибромиалгия и гипертрофия / атрофия скелетных мышц25–27; рак28,29; и хронические инфекции.30,31

Исследователям хорошо известно, что митохондриальные генетические или первичные митохондриальные нарушения способствуют митохондриальной дисфункции и вторичным или приобретенным дегенеративным нарушениям.32 Этот обзор будет сосредоточен на негенетических или приобретенных механизмах, которые могли бы объяснить митохондриальную дисфункцию и их заместительное лечение естественными добавки и комбинации натуральных добавок, включая витамины, минералы, кофакторы ферментов, антиоксиданты, метаболиты, переносчики, фосфолипиды мембранного типа и другие натуральные добавки.

Митохондриальная молекулярная дисфункция

Митохондриальная дисфункция возникает из-за недостаточного количества митохондрий, неспособности обеспечить митохондрии необходимыми субстратами или дисфункции их механизмов транспорта электронов и синтеза АТФ. Число и функциональный статус митохондрий в клетке можно изменить путем (1) слияния частично дисфункциональных митохондрий и смешивания их неповрежденных компонентов для улучшения общей функции, (2) генерации совершенно новых митохондрий (деление) и (3) удаление и полная деградация дисфункциональных митохондрий (митофагия).33 Эти события контролируются сложными клеточными процессами, которые определяют ухудшение митохондрий, например деполяризацию митохондриальных мембран или активацию определенных путей транскрипции. 34,35

Способность клеток производить почти все высокоэнергетические молекулы, такие как АТФ напрямую связан со способностью митохондрий (1) преобразовывать энергию метаболитов в восстановленный никотинамидадениндинуклеотид (НАДН) и (2) переносить электроны от НАДН к цепи переноса электронов и, в конечном итоге, к молекулярному кислороду, перекачивая протоны из митохондрий. матрикс через внутреннюю митохондриальную мембрану в межмембранное пространство.Этот процесс создает трансмембранный протонный градиент (Δp) и электрохимический градиент (Δψ m ) на внутренней мембране митохондрий.36,37 Трансмембранный потенциал, создаваемый протонным градиентом, затем использует АТФ-синтазу для протекания протонов обратно через внутреннюю митохондриальную мембрану. и использует энергию этого процесса для стимулирования фосфорилирования аденозиндифосфата (АДФ) до АТФ.36,38

Следствием процесса переноса электронов является производство активных форм кислорода (АФК), высокоактивных свободных радикалов, которые образуются как побочный продукт окислительного фосфорилирования.Основными источниками АФК и связанных с ними активных форм азота (РНС) являются митохондрии, и эти свободные радикалы могут повреждать клеточные липиды, белки и ДНК.39–41. Однако некоторые механизмы могут нейтрализовать АФК / РНС; Ферменты дисмутазы и антиоксиданты могут контролировать избыточное количество ROS / RNS.42,43 Помимо создания ROS / RNS, процесс переноса электронов может вызывать разобщение белков, что приводит к контролируемой утечке протонов обратно через протонный градиент внутренней митохондрии. мембраны в митохондриальный матрикс.36,37 Эта утечка приводит к снижению выработки АТФ, в то время как он все еще потребляет избыточный кислород. 43

В присутствии контролируемой утечки протонов избыточное потребление кислорода и, как следствие, производство ROS может привести к несоответствующему повреждению липидов митохондриальной мембраны, 41,42 таких как очень чувствительный к АФК / РНС кардиолипин, фосфолипид внутренней митохондриальной мембраны.44 Окислительное повреждение кардиолипина и других мембранных фосфолипидов во внутренней митохондриальной мембране может привести к увеличению утечки протонов и ионов обратно через внутреннюю мембрану в матрикс митохондрий и частичная потеря электрохимического градиента.Кардиолипин также является важным компонентом цепи переноса электронов, обеспечивая стабильность комплексов цитохром / фермент во внутренней митохондриальной мембране.44 При неблагоприятном повреждении ROS / RNS окисленный кардиолипин вызывает потерю функции транспорта электронов.45

Клеточный антиоксидант Защитные механизмы обычно поддерживают уровни ROS / RNS в концентрациях, которые предотвращают избыточное окисление клеточных молекул. 46–48 Клеточная антиоксидантная защита, которая является эндогенной, опосредуется глутатионпероксидазой, каталазой и супероксиддисмутазой, среди других ферментов.48,49 Кроме того, некоторые диетические антиоксиданты с низкой молекулярной массой могут влиять на антиоксидантный статус.50,51 Некоторые из этих диетических антиоксидантов использовались в качестве естественных профилактических средств для снижения избыточных концентраций окислительных молекул до физиологических уровней, которые могут поддерживаться за счет эндогенные антиоксидантные системы.52

Митохондриальная дисфункция и усталость

Митохондриальная дисфункция напрямую связана с избыточной утомляемостью. Усталость считается многомерным ощущением, которое воспринимается как потеря общей энергии и неспособность выполнять даже простые задачи без напряжения.53,54 Хотя легкая усталость может быть вызвана рядом состояний, включая депрессию и другие психологические состояния, умеренная и тяжелая усталость затрагивает энергетические системы клеток. 53,54 На клеточном уровне умеренная или тяжелая усталость связана с потерей функции митохондрий. и снижение выработки АТФ.54–56 Неизлечимая усталость, продолжающаяся более 6 месяцев, которая не снимается сном (хроническая усталость), является наиболее частой жалобой пациентов, обращающихся за общей медицинской помощью.53,57 Хроническая усталость также является важным вторичным состоянием при лечении. многие клинические диагнозы, часто предшествующие первичному диагнозу пациента.57,58

В результате старения и хронических заболеваний окислительное повреждение митохондриальных мембран нарушает функцию митохондрий.59–61 Например, люди с синдромом хронической усталости имеют признаки окислительного повреждения ДНК и липидов, 61,62 таких в виде маркеров окисленной крови63 и окисленных липидов мембран 64, что указывает на избыточный окислительный стресс. У этих людей также наблюдается устойчивый повышенный уровень пероксинитрита, вызванный избытком оксида азота, что также может привести к перекисному окислению липидов и потере функции митохондрий, а также к изменениям уровней цитокинов, которые оказывают положительную обратную связь на производство оксида азота.65

Натуральные добавки и митохондриальная дисфункция

Ряд натуральных добавок использовался для лечения непсихологической усталости и митохондриальной дисфункции.32,54,66 Эти добавки включают добавки, содержащие витамины, минералы, антиоксиданты, метаболиты, ингибиторы ферментов и кофакторы митохондрий. транспортеры, травы и мембранные фосфолипиды (32) .Хотя несколько натуральных добавок использовались для снижения утомляемости, лишь немногие из них считаются действительно эффективными.67 В этой статье будут рассмотрены некоторые из наиболее многообещающих добавок, а в заключении будут рассмотрены комбинации конкретных добавок, которые использовались. для лечения трудноизлечимой хронической усталости и улучшения функции митохондрий.

Таблица 1

Неполный список ингредиентов / агентов, которые практикующие врачи использовали или предлагали для лечения митохондриальной дисфункции a

ингибиторы

900 55

Категория Примеры
Витамины Витамины C, D и E, тиамин, рибофлавин
Минералы Магний, кальций, фосфат
Липиды Мембранные фосфолипиды, ненасыщенные жирные кислоты
Метаболиты Креатин, пируват
Кофакторы 10 , α-липоевая кислота, НАДН, никотиновая кислота
Транспортеры l-карнитин, мембранные фосфолипиды
Антиоксиданты CoQ 10 , α-липоевая кислота, НАДН, глутатион
α-липоевая кислота, дихлорацетат
Травы Куркумин, схизандрин

α-липоевая кислота

Альфа-липоевая кислота (α-липоевая кислота [1,2-дитиолан-3-пентановая кислота]) является мощным антиоксидантом, хелатором переходных металлов. , редокс-регулятор транскрипции и противовоспалительное средство.68 Он действует как критический кофактор в митохондриальных дегидрогеназах α-кетокислот и, таким образом, играет важную роль в митохондриальных реакциях окислительно-декарбоксилирования.69,70 Клинически α-липоевая кислота использовалась в качестве пероральной добавки при лечении связанных с ней осложнений. с сахарным диабетом, и, согласно обзору Шэя и др., 70 было показано, что он способствует улучшению различных нейропатий, связанных с диабетом, воспалений и здоровья сосудов. В модельных клеточных системах эти эффекты приписывались главным образом α-липоевой кислоте, обладающей эффектами передачи сигнала на регуляцию генов, а также на поглощение и метаболизм глюкозы, а также на ее антиоксидантные эффекты.71

В результате старения и многих хронических заболеваний определенные сфинголипиды — особенно церамиды и, в частности, короткоцепочечные церамиды — накапливаются в митохондриях из-за гидролиза сфингомиелина сфингомиелиназой, и в конечном итоге это накопление замедляет активность транспорта электронов. 72,73 Накопление церамидов в митохондриях особенно опасно для сердечной ткани. У стареющих грызунов α-липоевая кислота использовалась для снижения уровней церамидов в эндотелиальных клетках сосудов сердечной мышцы за счет ингибирования активности сфингомиелиназы, что приводило к восстановлению уровней митохондриального глутатиона и увеличению функции транспорта электронов.74

Как упоминалось выше, при диабете α-липоевая кислота широко используется для уменьшения диабетических осложнений, таких как сенсомоторные полинейропатии.75 Одно 4-летнее слепое исследование продемонстрировало, что некоторые невропатические нарушения значительно улучшились на α-липоевой кислоте (но не атрибуты нервной проводимости), демонстрируя клиническую полезность антиоксиданта и безопасность длительного лечения α-липоевой кислотой для пациентов с диабетом.76

В качестве пероральной добавки α-липоевая кислота редко присутствует в тканях выше микромолярных уровней; таким образом, маловероятно, что он будет непосредственно задействован в качестве важного первичного клеточного антиоксиданта.70 Однако его способность повышать уровень клеточного глутатиона является важным антиоксидантным свойством, и это повышение достигается за счет регулирования синтеза глутатиона и, таким образом, уменьшения окислительного стресса.77 Этот антиоксидант может влиять на регуляцию ядерного фактора транскрипции NF-κΒ, и, таким образом, , он может вызывать широко распространенные транскрипционные эффекты, приводящие к ослаблению выработки свободных радикалов и цитотоксических цитокинов.78

Как хелатор переходных металлов, α-липоевая кислота может удалять избыток меди, железа и других металлов, которые участвуют в хронических заболеваниях. , таких как гемохроматоз, терминальная стадия почечной недостаточности и болезни Альцгеймера и Паркинсона, и он является потенциальным терапевтическим средством для предотвращения или смягчения отравлений тяжелыми металлами.68 Он также улучшает когнитивные функции и функцию митохондрий, предполагая связь между окислительным повреждением митохондрий и когнитивными функциями.79 Использование α-липоевой кислоты при хронической усталости еще не изучалось в контролируемых клинических испытаниях, но ее широкое распространение в качестве безопасной добавки (обычно 200-600 мг / сут) 70 для поддержки функции митохондрий и снижения окислительного стресса оправдало его включение в различные смеси добавок 70,76,78

l-карнитин

l-карнитин (3-гидрокси-4- -триметиламинобутират) представляет собой естественный переносчик жирных кислот, обнаруживаемый у всех видов млекопитающих.Он непосредственно участвует в транспорте жирных кислот в матрикс митохондрий для последующего β-окисления, но он также действует в удалении избыточных ацильных групп из организма и в модуляции гомеостатаза внутриклеточного кофермента A (CoA )80,81. из-за его важности в окислении жирных кислот и гомеостатазе КоА и ацил-КоА, l-карнитин обычно поддерживается в относительно узких пределах концентрации; таким образом, диетические добавки важны для поддержания необязательных концентраций l-карнитина в клетках.81 Действительно, нарушения, связанные с дефицитом l-карнитина, связаны со снижением функции митохондрий, инсулинорезистентностью и ишемической болезнью сердца. 82–84

Важная роль l-карнитина в митохондриальном метаболизме стимулировала использование добавок l-карнитина для потенциально улучшения физическая работоспособность.85 Обоснование этого состоит в том, что повышенная зависимость от жира в качестве основного субстрата для производства энергии во время экстремальных упражнений должна снизить потребность в углеводах и замедлить истощение запасов углеводов, и что эти изменения должны увеличить общую выработку энергии и снизить утомляемость, вызванную физическими упражнениями. .Транспортировка жирных кислот в митохондрии также требует повышенных уровней l-карнитина и, таким образом, указывает на необходимость пищевых добавок l-карнитина. Однако исследования показали, что увеличение количества пероральных добавок l-карнитина, даже за 2-3 недели до экстремальных упражнений, не приводит к увеличению содержания карнитина в скелетных мышцах. Следовательно, маловероятно, что эта добавка изменяет метаболизм мышц во время экстремальных упражнений. 86,87

Добавка с l-карнитином успешно используется при клинических заболеваниях, которые характеризуются низкими концентрациями l-карнитина или нарушением окисления жирных кислот, таких как диабет. , сепсис, почечная недостаточность и кардиомиопатия.80 Например, в небольшом исследовании с участием 18 человек с застойной сердечной недостаточностью и 12 человек из контрольной группы плацебо добавление пропионил-1-карнитина приводило к увеличению пиковой частоты сердечных сокращений (в среднем 12%), переносимости физических нагрузок (в среднем 21%) и максимальной частоты сердечных сокращений. потребление кислорода (в среднем 45%) в группе лечения.88

Важным средством против старения l-карнитина было увеличение скорости митохондриального окислительного фосфорилирования, которое естественным образом снижается в результате старения. Это снижение снижает производство энергии, но увеличивает производство ROS / RNS.Было обнаружено, что кормление старыми крысами ацетил-1-карнитином обращает вспять возрастное снижение уровня l-карнитина, одновременно увеличивая метаболизм жирных кислот. Он также обратил вспять возрастное снижение уровня клеточного глутатиона и улучшил активность комплекса IV митохондрий мышц.89

Хотя диетические добавки с l-карнитином и его различными производными представляются безопасными (дозы до 2 г / день) 90 и потенциально полезный для увеличения функции митохондрий, исследователи не провели необходимых множественных клинических испытаний, чтобы показать его эффективность при большинстве хронических заболеваний, связанных с возрастом (кроме диабета и сердечно-сосудистых заболеваний).Единственным исключением было рандомизированное контролируемое клиническое исследование с участием 70 долгожителей, получавших l-карнитин в течение 6 месяцев. У этих участников обычно обнаруживалась мышечная слабость, ухудшение психического здоровья, нарушение подвижности и плохая выносливость. К концу исследования в группе, получавшей лечение, наблюдались значительные улучшения в плане физической усталости, умственной утомляемости и тяжести утомляемости. Они также показали снижение общей жировой массы, увеличение мышечной массы и повышение способности к физической и когнитивной активности за счет снижения утомляемости и улучшения когнитивных функций.91 Другие исследования алкоголизма, печеночной энцефалопатии, ишемической болезни сердца, болезни Пейрони, церебральной ишемии и бесплодия показали, что введение l-карнитина может оказывать положительное влияние на признаки и симптомы этих состояний. 90

Коэнзим Q

10

Коэнзим Q 10 (CoQ 10 [убихинон]) является ключевым кофактором и компонентом митохондриальной цепи переноса электронов и одной из наиболее широко используемых природных добавок.32,92 Он также является сильным антиоксидантом в его восстановленной форме. и это может влиять на экспрессию определенных генов, участвующих в передаче сигналов, метаболизме и транспорте клеток.92,93 Однако основная роль CoQ 10 заключается в его участии в переносе электронов по множественным комплексам митохондриальной цепи переноса электронов.92,94 Клинически он использовался в дозах до 1200 мг в день, но в большинстве исследований использовались более низкие дозы.92

Поскольку CoQ 10 является важным компонентом митохондриальной системы окислительного фосфорилирования, его добавление к людям с пониженными уровнями должно приводить к увеличению выработки энергии и снижению утомляемости.92,94 Систематический обзор эффектов CoQ 10 при физических упражнениях, гипертонии и сердечной недостаточности, проведенный Розенфельдтом и соавторами 95, показал, что 6 из 11 опубликованных исследований показали умеренное улучшение переносимости упражнений у участников, получавших CoQ 10 с пищей. . В 8 исследованиях, в которых изучалось влияние CoQ 10 на гипертонию, наблюдалось среднее снижение артериального давления: систолическое, среднее снижение на 16 мм рт. и диастолическое, среднее снижение на 10 мм рт. В обзоре 9 рандомизированных испытаний, в которых изучалось использование CoQ 10 у участников с сердечной недостаточностью, показали незначительные тенденции к увеличению фракции инъекций и снижению смертности.Rosenfeldt et al95 провели собственное трехмесячное рандомизированное плацебо-контролируемое исследование эффектов перорального приема CoQ 10 у 35 пациентов с сердечной недостаточностью и обнаружили, что участники группы CoQ 10 , но не контрольной группы, показали значительное улучшение симптомов.95 Исследование также показало тенденцию к улучшению средней продолжительности упражнений.95

Также изучались эффекты перорального приема CoQ 10 во время физических упражнений. В слепом перекрестном исследовании 17 здоровых участников получали CoQ 10 или плацебо в течение 8 дней, а затем их работоспособность оценивалась дважды при фиксированных нагрузках на велоэргометре в течение 2 часов с 4-часовым отдыхом между тестами.96 Участники, принимавшие CoQ 10 , смогли достичь более высоких результатов работы и меньше ощущали усталость, и их потребность в периоде восстановления была уменьшена по сравнению с группой плацебо. 96

Клинически CoQ 10 использовался для уменьшения симптомы и прогрессирование различных нейродегенеративных заболеваний.92,94 В исследованиях с использованием моделей болезни Альцгеймера введение CoQ 10 значительно замедляло атрофию мозга и типичную патологию β-амилоидных бляшек.97,98 В рандомизированном, плацебо-контролируемом, 16-недельном исследовании. В клиническом испытании 98 участников с болезнью Альцгеймера, которые принимали пероральную смесь CoQ 10 , витаминов C и E и α-липоевой кислоты, группа испытаний показала значительное снижение маркеров оксидативного стресса, но не показала значительных изменений в спинномозговой жидкости (CSF). ) маркеры, относящиеся к патологии β-амилоида или тау.99

При болезни Паркинсона у людей, как правило, наблюдается повышенное соотношение окисленного CoQ к общему количеству 10 и значительное увеличение маркеров окислительного повреждения в спинномозговой жидкости, которое можно частично обратить вспять с помощью введения CoQ 10 100. Болезнь Хантингтона, исследование Huntington Study Group показало, что прием CoQ 10 в течение 30 месяцев замедлял обычное снижение общей функциональной способности, но различия не достигли статистической значимости.101 Наконец, в многоцентровом плацебо-контролируемом исследовании фазы II с участием пациентов с боковым амиотрофическим склерозом CoQ 10 существенно не повлиял на функциональное снижение за 9-месячный период, 102 и Мэтьюз и др. 103 не обнаружили CoQ 10 . плюс несколько витаминов, которые будут эффективны у людей с генетическими митохондриальными заболеваниями.

Никотинамид-аденин-динуклеотид

НАДН действует как клеточный окислительно-восстановительный кофактор в более чем 200 клеточных окислительно-восстановительных реакциях и как субстрат для определенных ферментов.104,105 Люди повсеместно нуждаются в НАДН, и его дефицит приводит к пеллагре, которая характеризуется дерматитом, диареей, слабоумием и, в конечном итоге, смертью.104 В митохондриях НАДН доставляет электроны от гидролиза метаболитов в цепь переноса электронов, но в его восстановленной форме, он также может действовать как сильный антиоксидант. Обычный путь приема пищевых добавок исторически заключался в использовании предшественников НАДН, таких как ниацин, никотиновая кислота или никотинамид, но в последнее время для стабилизации перорального НАДН стали использовать микроносители, чтобы его можно было непосредственно проглатывать в небольших дозах и всасываться в желудочно-кишечной системе. .Эта добавка оказывается более эффективной, чем большие пероральные дозы НАДН, как в некоторых исследованиях, которые использовали до 50 мг / кг / день. При таком размере дозы НАДН склонен к окислению и деградации, и такие добавки обычно считаются неэффективными.106

При нейродегенеративных заболеваниях окислительное повреждение является обширным, 1,2 и для лечения заболевания используются различные митохондриальные антиоксиданты. и задерживают прогрессирование.1–6,32 Одно исследование показало, что при болезни Альцгеймера стабилизированный пероральный НАДН может улучшить когнитивные функции и деменцию106; однако другое клиническое испытание не показало никаких доказательств улучшения когнитивных функций или деменции при пероральном приеме НАДН.107 В контролируемом исследовании с 26 участниками с болезнью Альцгеймера, которым давали стабилизированный НАДН или плацебо в течение 6 месяцев, Дермин и др. 108 обнаружили, что тестовая группа имела значительно лучшие результаты, чем группа плацебо, по беглости речи и визуальному построению, и показала тенденцию к увеличению выступление на абстрактном словесном рассуждении. Тем не менее, исследование не предоставило доказательств лучшей эффективности в отношении показателей внимания или памяти или оценки степени тяжести деменции.

Стабилизированный пероральный НАДН также использовался для облегчения симптомов болезни Паркинсона.В предварительном открытом клиническом исследовании Birkmayer et al109 изучили эффекты внутривенного и перорального приема НАДН у более чем 800 человек с болезнью Паркинсона. Они обнаружили, что 19,3% участников показали снижение инвалидности от 30% до 50%; У 58,8% наблюдалось умеренное (10–30%) улучшение; и 21,8% не ответили на терапию ( P <0,01). Более молодые пациенты с более короткой продолжительностью заболевания имели гораздо больше шансов ответить и показать более значительные улучшения, чем пожилые пациенты или пациенты с более длительной продолжительностью заболевания.Пероральная форма была сопоставима с внутривенным введением НАДН по своим эффектам.109 Однако, когда они повторили этот тип исследования, Диздар и др. 110 не обнаружили статистически значимых улучшений в оценочных показателях болезни Паркинсона у участников, получавших НАДН, а также не было обнаружено различий в показателях оценки болезни Паркинсона. Клинические маркеры ЦСЖ, связанные с тяжестью болезни Паркинсона.

Стабилизированный пероральный НАДН также используется для уменьшения симптомов у пациентов с хронической усталостью. Одно из таких исследований с участием людей с синдромом хронической усталости было разработано для лечения участников стабилизированным пероральным НАДН или плацебо в течение 4 недель в перекрестном исследовании.111 Из этих участников 8 из 26 (30,7%) положительно ответили на микрокапсулированный НАДН по сравнению с 2 из 26 (8%) в группе плацебо ( P <0,05) .111 Очевидно, что эффект имел место, но только в подгруппе участников испытания; таким образом, эти результаты не были сочтены другими значимыми.112 Клиническое испытание, в котором сравнивали пероральный стабилизированный НАДН с психологической / диетической терапией у 31 человека с синдромом хронической усталости, показало, что один только стабилизированный НАДН снижает утомляемость в первые 4 месяца 12-месячного периода. испытание.Однако после первых 4 месяцев оценки симптомов в двух группах исследования были схожими.113 В другом исследовании стабилизированный НАДН давали перорально в течение 2 месяцев для лечения лиц с синдромом хронической усталости.114 Это лечение привело к снижению тревожности и при максимальной частоте сердечных сокращений после стресс-теста, но Alegre et al114 обнаружили мало или совсем не обнаружили различий в функциональном влиянии на утомляемость, качество жизни, качество сна, работоспособность или функциональный резерв. Таким образом, один только стабилизированный НАДН показал смешанные результаты при различных заболеваниях и расстройствах, и не все пациенты ответили на пероральные стабилизированные добавки.

Мембранные фосфолипиды

Диетическое замещение фосфолипидов митохондриальных мембран (липидозамещающая терапия [LRT]) с использованием молекул пищевого происхождения для удаления поврежденных, в основном окисленных, мембранных липидов в митохондриях и других клеточных органеллах оказалось очень эффективным для увеличения митохондриальной функции и снижение утомляемости.10,23,54,55 В некоторой степени антиоксидантные добавки могут снижать уровни ROS / RNS и предотвращать некоторое окисление фосфолипидов митохондриальной мембраны, но сами по себе антиоксиданты не могут восстановить уже нанесенный ущерб клеткам и, в частности, клеткам ». внутренние мембраны митохондрий.29,55,115

Использование фосфолипидов мембран полости рта плюс антиоксиданты в дозах от 500 до 2000 мг в день было эффективным при лечении определенных клинических состояний, таких как хроническая усталость и утомляющие заболевания. 55,67,115–117 LRT приводит к фактическая замена поврежденных мембранных фосфолипидов неповрежденными (неокисленными) липидами для обеспечения надлежащего функционирования клеточных и особенно митохондриальных мембран.

Фосфолипиды оральных мембран могут увеличивать функцию митохондрий и снижать утомляемость при синдроме хронической усталости, синдроме фибромиалгии и других утомляющих состояниях, включая естественное старение ().Например, смесь мембранных фосфолипидов и витаминов (Propax с NT-фактором) использовалась Ellithorpe et al117 в исследовании стареющих людей с тяжелой хронической усталостью, и было обнаружено, что они снижают их утомляемость на 40,5% за 8 недель. В этих исследованиях утомляемость отслеживалась с помощью шкалы Piper Fatigue Scale (PFS) для измерения клинической утомляемости и качества жизни.58 В последующем перекрестном исследовании изучалось влияние мембранных фосфолипидов на утомляемость и функцию митохондрий у пациентов с умеренной и тяжелой степенью тяжести. началась хроническая усталость.55 Пероральное введение NT-фактора в течение 12 недель привело к снижению утомляемости на 35,5% и увеличению функции митохондрий на 26,8%, тогда как после 12-недельного периода вымывания утомляемость увеличилась, а функция митохондрий снизилась до контрольных уровней. снижение наблюдалось у людей с синдромом хронической усталости и синдромом фибромиалгии, которым давали пероральные мембранные фосфолипиды (NT-фактор) .116 Использование нового состава NT-фактора плюс витамины, минералы и другие добавки у людей с умеренной хронической усталостью привело к 36.Снижение утомляемости на 8% в течение 1 недели () 118

Таблица 2

Прием пероральных мембранных фосфолипидов и усталость у хронически больных a

Участники / пациенты n Средний возраст Среднее время на LRT PFS Снижение утомляемости (%) Ссылка
Хроническая усталость 34 50,3 8 недель 40,5 c Ellithorpe et al. 20 68.9 12 недель 35,5 b Агаджанян и др. 55
Синдром хронической усталости (и / или синдром фибромиалгии) 15 44,8 8 недель 43,1 bolson Nic Ellithorpe116
Старение, усталость 67 57,3 1 нед 36,8 b Nicolson et al118
Хронические болезни 58 55.0 8 недель 30,7 b Nicolson et al 119

Комбинированная пероральная добавка для снижения утомляемости

В двухмесячном испытании лечения длительной трудноизлечимой усталости у пациентов с различными заболеваниями. диагнозов, автор и несколько коллег объединили мембранные фосфолипиды (2000 мг / сут), CoQ 10 (35 мг / сут), микрокапсулированный НАДН (35 мг / сут), l-карнитин (160 мг / сут), α-кетоглутаровую кислоту. кислота (180 мг / сут) и другие питательные вещества в пероральную добавку (топливо АТФ) для лечения усталости и митохондриальной дисфункции.119 120 58 участников этого испытания имели трудноизлечимую утомляемость от умеренной до тяжелой в течение в среднем> 17 лет и в среднем у> 15 практикующих, но без разрешения их усталость. В исследование были включены 30 человек с синдромом хронической усталости; 17 с хронической болезнью Лайма; 16 с другими изнуряющими заболеваниями, включая синдром фибромиалгии и болезнь войны в Персидском заливе; 4 с аутоиммунным заболеванием, включая ревматоидный артрит; 2 с раком; и 2 с диабетом. Эти пациенты безуспешно пробовали множество лекарств и добавок (в среднем> 35), чтобы уменьшить их усталость.

Участники этого испытания принимали комбинированную добавку LRT (ATP Fuel) в течение 8 недель, и усталость оценивалась с помощью PFS.119 PFS — это проверенный инструмент, который измеряет четыре измерения субъективной усталости: поведенческие / серьезность, аффективные / значимые, сенсорное и когнитивное / настроение.58 В исследовании использовался инструмент для расчета четырех подшкал или баллов по измерениям и общего балла утомляемости. У участников был начальный, общий, средний балл усталости от ВБП 7,51 ± 0,29, а после 8 недель приема добавок средний балл улучшился до 5.21 ± 0,28, или 30,7% снижение утомляемости ( t тест , P <0,0001; знаковый ранг Уилкоксона, P <0,0001) .119

баллов PFS можно разделить на 4 подкатегории: (1) подкатегория поведения / серьезности, которая связана с выполнением задач, общением и участием в сексуальных и других действиях, а также с интенсивностью или степенью утомляемости; (2) аффективная / значимая подкатегория, которая определяет, считает ли человек усталость / усталость приятной или неприятной, приятной или неприятной, защитной или деструктивной, нормальной или ненормальной; (3) сенсорная подкатегория, которая определяет, чувствует ли человек себя сильным или слабым, бодрствующим или сонным, бодрым или усталым, энергичным или неэнергетическим; и (4) подкатегория когнитивных способностей / настроения, которая оценивает, чувствует ли человек расслабленное или напряженное, возбужденное или подавленное, способное или неспособное сконцентрироваться, запомнить и ясно мыслить.В исследовании, обсуждаемом в этом разделе, все эти подкатегории показали значительное снижение к концу 8-недельного испытания ( P <.0001), что указывает на значительные улучшения во всех подкатегориях утомляемости. Например, произошло снижение на 30,7% ( P <0,0001) выраженности / поведения утомляемости, что указывает на значительное снижение интенсивности утомляемости и значительное повышение способности выполнять задачи, общаться, заниматься сексом и заниматься сексом. другие занятия.Кроме того, на 28,0% улучшилось настроение и когнитивные способности, такие как способность концентрироваться, запоминать и ясно мыслить.119

Регрессионный анализ данных об утомляемости

Для определения тенденций утомляемости снижение в результате использования участниками комбинированной добавки LRT (мембранные фосфолипиды, CoQ 10 , NADH, l-карнитин, α-кетоглутаровая кислота и другие ингредиенты) за время испытания, автор и его коллеги провели регрессию анализ данных, чтобы определить, были ли результаты (1) согласованными, (2) полученными с высокой степенью достоверности и (3) могли предсказать дальнейшее снижение утомляемости.119 Регрессионный анализ общей утомляемости и каждой из подкатегорий утомляемости показал значительные и последовательные тенденции к снижению данных утомляемости, предполагая, что дальнейшее снижение утомляемости было бы вероятным, если бы исследование было продолжено. Значения регрессии R 2 для различных подгрупп: (1) поведение / серьезность, 0,956; (2) аффективное значение 0,960; (3) сенсорный — 0,950; и (4) когнитивные функции / настроение — 0,980. Регрессионный анализ общей усталости дал R 2 = 0.960. Этот результат показал, что существует высокий уровень достоверности и воспроизводимости тенденций к снижению всех данных об утомляемости. Комбинированная добавка LRT была безопасна, и в ходе исследования не возникло никаких проблем с безопасностью.119 Изучение оценок, полученных от лиц с синдромом хронической усталости, болезнью Лайма или другими диагностическими категориями, не выявило серьезных различий в общей усталости или ее снижении с помощью комбинированной добавки. .119,120

Резюме

Пероральные натуральные добавки, содержащие мембранные фосфолипиды, CoQ 10 , микрокапсулированный НАДН, l-карнитин, α-липоевая кислота и другие питательные вещества, могут помочь восстановить функцию митохондрий и уменьшить стойкую усталость у пациентов с хроническими заболеваниями.Комбинация этих добавок может стать безопасным и эффективным методом снижения усталости и помочь восстановить качество жизни.

Сноски

Заявление автора о раскрытии информации

Автор не получал финансовой выгоды и не имел конфликта интересов в отношении продуктов, обсуждаемых в этой статье.

Ссылки

3. Грин Д.Р., Галлуцци Л., Кремер Г. Митохондрии и ось аутофагия-воспаление-гибель клеток при старении организма.Наука. 2011. 333 (6046): 1109–1112. [Бесплатная статья PMC] [PubMed] [Google Scholar] 4. Редди PH, Редди TP. Митохондрии как терапевтическая мишень при старении и нейродегенеративных заболеваниях. Curr Alzheimer Res. 2011. 8 (4): 393–409. [Бесплатная статья PMC] [PubMed] [Google Scholar] 5. Карбовски М., Нойцнер А. Нейродегенерация как следствие нарушения поддержания митохондрий. Acta Neuropathol. 2012. 123 (2): 157–171. [PubMed] [Google Scholar] 6. Виктор В.М., Апостолова Н., Херанс Р., Эрнандес-Миярес А., Роча М. Окислительный стресс и митохондриальная дисфункция при атеросклерозе: антиоксиданты, нацеленные на митохондрии, как потенциальная терапия.Curr Med Chem. 2009. 16 (35): 4654–4667. [PubMed] [Google Scholar] 7. Лимонгелли Дж., Масароне Д., Д’Алессандро Р., Эллиотт П.М. Митохондриальные заболевания и сердце: обзор молекулярных основ, диагностики, лечения и клинического течения. Кардиол будущего. 2012. 8 (1): 71–88. [PubMed] [Google Scholar] 8. Ма З.А., Чжао З., Тюрк Дж. Дисфункция митохондрий и недостаточность бета-клеток при сахарном диабете 2 типа. Exp Diabetes Res. 2012; 2012: 703538. DOI: 10,1155 / 2012/703538. [Бесплатная статья PMC] [PubMed] [Google Scholar] 9.Джозеф А.М., Жоанисс Д.Р., Байо Р.Г., Худ Д.А. Митохондриальная дисрегуляция в патогенезе диабета: потенциал для вмешательств, опосредованных митохондриальным биогенезом. Exp Diabetes Res. 2012; 2012: 642038. DOI: 10,1155 / 2012/642038. [Бесплатная статья PMC] [PubMed] [Google Scholar] 10. Николсон ГЛ. Метаболический синдром и функция митохондрий: молекулярная замена и антиоксидантные добавки для предотвращения перекисного окисления мембран и восстановления функции митохондрий. J Cell Biochem. 2007. 100 (6): 1352–1369. [PubMed] [Google Scholar] 11.Гафурифар П., Мусавизаде К., Парихар М.С., Назаревич Р.Р., Парихар А., Зенебе В.Дж. Митохондрии при рассеянном склерозе. Передние биоски. 2008, январь; 13: 3116–3126. [PubMed] [Google Scholar] 14. Майез К., Морхан С.Д., Чонг З.З. Биология окислительного стресса и повреждение клеток при сахарном диабете 1 и 2 типа. Curr Neurovasc Res. 2007. 4 (1): 63–71. [Бесплатная статья PMC] [PubMed] [Google Scholar] 15. Россиньоль Д.А., Фрай Р.Э. Дисфункция митохондрий при расстройствах аутистического спектра: систематический обзор и метаанализ.Мол Психиатрия. 2012. 17 (3): 290–314. [Бесплатная статья PMC] [PubMed] [Google Scholar] 16. Palmieri L, Persico AM. Митохондриальная дисфункция при расстройствах аутистического спектра: причина или следствие? Biochim Biophys Acta. 2010. 1797 (6–7): 1130–1137. [PubMed] [Google Scholar] 17. Prince JA, Harro J, Blennow K, Gottfries CG, Oreland L. Энергетический метаболизм митохондрий путамена сильно коррелирует с эмоциональными и интеллектуальными нарушениями у шизофреников. Нейропсихофармакология. 2000. 22 (3): 284–292. [PubMed] [Google Scholar] 18.Маразцити Д., Барони С., Пиккети М. и др. Психиатрические расстройства и митохондриальные дисфункции. Eur Rev Med Pharmacol Sci. 2012. 16 (2): 270–275. [PubMed] [Google Scholar] 19. Конради С., Итон М., Макдональд М.Л., Уолш Дж., Бенес Ф.М., Хекерс С. Молекулярные доказательства митохондриальной дисфункции при биполярном расстройстве. Arch Gen Psychiatry. 2004. 61 (3): 300–308. [PubMed] [Google Scholar] 20. Chitkara DK, Nurko S, Shoffner JM, Buie T., Flores A. Нарушения моторики желудочно-кишечного тракта связаны с заболеваниями окислительного фосфорилирования у детей.Am J Gastroenterol. 2003. 98 (4): 871–877. [PubMed] [Google Scholar] 21. Ди Донато С. Мультисистемные проявления митохондриальных нарушений. J Neurol. 2009. 256 (5): 693–710. [PubMed] [Google Scholar] 22. Norheim KB, Jonsson G, Omdal R. Биологические механизмы хронической усталости. Ревматология (Оксфорд) 2011; 50 (6): 1009–1018. [PubMed] [Google Scholar] 23. Николсон Г.Л., Николсон Н.Л., Бернс П., Насралла М.Ю., Хайер Дж., Насс М. Болезни войны в Персидском заливе: химические, радиологические и биологические воздействия, приводящие к хроническим утомляющим заболеваниям, можно идентифицировать и лечить.J Syndr. Хронической усталости. 2003. 11 (1): 135–154. [Google Scholar] 24. Myhill S, Booth NE, McLaren-Howard J. Синдром хронической усталости и митохондриальная дисфункция. Int J Clin Exp Med. 2009; 2 (1): 1–16. [Бесплатная статья PMC] [PubMed] [Google Scholar] 25. Кордеро MD, де Мигель М, Кармона-Лопес I, Бонал П., Кампа F, Морено-Фернандес AM. Окислительный стресс и дисфункция митохондрий при фибромиалгии. Neuro Endocrinol Lett. 2010. 31 (2): 169–173. [PubMed] [Google Scholar] 26. Рабинович Р.А., Виларо Дж. Структурные и функциональные изменения периферических мышц у пациентов с хронической обструктивной болезнью легких.Curr Opin Pulm Med. 2010. 16 (2): 123–133. [Бесплатная статья PMC] [PubMed] [Google Scholar] 27. Селекция ПК, Рассел NC, Николсон Г.Л. Интегративная модель хронически активированных иммунно-гормональных путей, важных в генерации фибромиалгии. Br J Med Pract. 2012; 5 (3): a524 – a534. [Google Scholar] 28. Сотджа Ф., Мартинес-Оутскхорн У.е., Лисанти депутат. Окислительный стресс митохондрий вызывает прогрессирование опухоли и метастазирование: следует ли использовать антиоксиданты в качестве ключевого компонента лечения и профилактики рака? BMC Med.2011; 9: 62–67. [Бесплатная статья PMC] [PubMed] [Google Scholar] 29. Николсон ГЛ. Заместительная липидная терапия: нутрицевтический подход к снижению утомляемости, связанной с раком, и побочных эффектов противоопухолевой терапии при восстановлении функции митохондрий. Раковые метастазы Ред. 2010; 29 (3): 543–552. [PubMed] [Google Scholar] 30. Габридж MG. Метаболические последствия инфекции Mycoplasma pneumoniae. Isr J Med Sci. 1987. 23 (6): 574–579. [PubMed] [Google Scholar] 31. Ашида Х., Мимуро Х., Огава М. и др. Гибель клеток и заражение: палка о двух концах для выживания хозяина и патогена.J Cell Biol. 2011; 195 (6): 931–942. [Бесплатная статья PMC] [PubMed] [Google Scholar] 32. Керр Д.С. Лечение нарушений митохондриальной цепи транспорта электронов: обзор клинических испытаний за последнее десятилетие. Mol Genet Metab. 2010. 99 (3): 246–255. [PubMed] [Google Scholar] 34. Priault M, Salin B, Schaeffer J, Vallette FM, di Rago JP, Martinou JC. Нарушение биоэнергетического статуса и биогенеза митохондрий запускает митофагию у дрожжей. Смерть клетки отличается. 2005. 12 (12): 1613–1621. [PubMed] [Google Scholar] 35.Ли Дж., Джордано С., Чжан Дж. Аутофагия, митохондрии и окислительный стресс: перекрестные помехи и редокс-сигналы. Биохим Дж. 2012; 441 (2): 523–540. [Бесплатная статья PMC] [PubMed] [Google Scholar] 36. Rich PR, Marechal A. Дыхательная цепь митохондрий. Очерки Биохимии. 2010; 47: 1–23. [PubMed] [Google Scholar] 37. Николс Д.Г. Митохондриальные ионные цепи. Очерки Биохимии. 2010; 47: 25–35. [PubMed] [Google Scholar] 38. Divakaruni AS, Бренд MD. Регуляция и физиология утечки митохондриальных протонов. Физиология (Bethesda) 2011; 26 (3): 192–205.[PubMed] [Google Scholar] 39. Рихтер С., Парк Дж. У., Эймс Б. Н.. Нормальное окислительное повреждение митохондриальной и ядерной ДНК обширно. Proc Nat Acad Sci USA. 1998. 85 (17): 6465–6467. [Бесплатная статья PMC] [PubMed] [Google Scholar] 40. Штадтман Э. Введение в серию обзоров окислительно-модифицированных белков при старении и болезнях. Free Radic Biol Med. 2002; 32 (9): 789. [Google Scholar] 41. Спектор А.А., Йорек М.А. Липидный состав мембраны и клеточная функция. J Lipid Res. 1985. 26 (9): 1015–1035. [PubMed] [Google Scholar] 42.Спителлер Г. Является ли перекисное окисление липидов полиненасыщенных кислот единственным источником свободных радикалов, вызывающих старение и возрастные заболевания? Rejuvenation Res. 2010. 13 (1): 91–103. [PubMed] [Google Scholar] 43. Дюшен М.Р., Сабадкай Г. Роль митохондрий в заболеваниях человека. Очерки Биохимии. 2010. 47: 115–137. [PubMed] [Google Scholar] 44. Chicco AJ, Sparagna GC. Роль изменений кардиолипина в митохондриальной дисфункции и болезни. Am J Physiol Cell Physiol. 2007; 292 (1): C33 – C44. [PubMed] [Google Scholar] 45.Houtkooper RH, ВАЗ FM. Кардиолипин, сердце митохондриального метаболизма. Cell Mol Life Sci. 2008. 65 (16): 2493–2506. [PubMed] [Google Scholar] 46. Барбер Д.А., Харрис С.Р. Свободные кислородные радикалы и антиоксиданты: обзор. Am Pharm. 1994; NS34 (9): 26–35. [PubMed] [Google Scholar] 47. ВС Ю. Свободные радикалы, антиоксидантные ферменты и канцерогенез. Free Radic Biol Med. 1990. 8 (6): 583–599. [PubMed] [Google Scholar] 48. Фридович И. Супероксид-радикалы и супероксиддисмутазы. Анну Рев Биохим. 1995; 64: 97–112.[PubMed] [Google Scholar] 49. Чандра Джагетия Г., Раджаникант Г.К., Рао С.К., Шринат Балига М. Изменение глутатиона, глутатионпероксидазы, супероксиддисмутазы и перекисное окисление липидов аскорбиновой кислотой в коже мышей, подвергшихся фракционированному гамма-излучению. Clin Chim Acta. 2003. 332 (1–2): 111–121. [PubMed] [Google Scholar] 50. Эшбах Р., Лолигер Дж., Скотт BC и др. Антиоксидантное действие тимола, карвакрола, 6-гингерола, зингерона и гидрокситирозола. Food Chem Toxicol. 1994. 32 (1): 31–36. [PubMed] [Google Scholar] 51.Schwartz JL. Двойная роль питательных веществ как антиоксидантов и прооксидантов: их влияние на рост опухолевых клеток. J Nutr. 1996; 126 (4) доп: 1221S – 1227S. [PubMed] [Google Scholar] 52. Прасад К.Н., Коул В.С., Кумар Б., Прасад К.С.. Научное обоснование использования высоких доз множественных микронутриентов в качестве дополнения к стандартным и экспериментальным методам лечения рака. J Am Coll Nutr. 2001; 20 (5) доп .: 450S – 453S. [PubMed] [Google Scholar] 53. Kroenke K, Wood DR, Mangelsdorff AD, Meier NJ, Powell JB. Хроническая усталость в первичной медико-санитарной помощи: распространенность, характеристики пациентов и исход.ДЖАМА. 1988. 260 (7): 929–934. [PubMed] [Google Scholar] 54. Николсон Г.Л., Сеттинери Р. Липидозаместительная терапия: функциональный подход к питанию с новыми формулами для уменьшения клеточного окислительного повреждения, связанной с раком усталости и побочных эффектов противоопухолевой терапии. Funct Foods Health Dis. 2011; 1 (4): 135–160. [Google Scholar] 55. Агаджанян М, Василевко В, Гочикян А и др. Пищевая добавка (NTFactor) восстанавливает функцию митохондрий и снижает утомляемость средней степени тяжести у пожилых людей.J Syndr. Хронической усталости. 2003. 11 (3): 23–26. [Google Scholar] 56. Бут NE, Myhill S, McLaren-Howard J. Митохондриальная дисфункция и патофизиология миалгического энцефаломиелита / синдрома хронической усталости (ME / CFS) Int J Clin Esp Med. 2012. 5 (3): 208–220. [Бесплатная статья PMC] [PubMed] [Google Scholar] 57. Моррисон JD. Усталость как жалоба в семейной практике. J Family Pract. 1980. 10 (5): 795–801. [PubMed] [Google Scholar] 58. Пайпер Б.Ф., Линси А.М., Додд М.Дж. Механизмы утомления у онкологических больных: разработка теории сестринского дела.Онкол Нурс Форум. 1987. 14 (6): 17–23. [PubMed] [Google Scholar] 59. Вэй ЙХ, Ли ХК. Окислительный стресс, мутации митохондриальной ДНК и нарушение антиоксидантных ферментов при старении. Exp Biol Med (Maywood) 2002; 227 (9): 671–682. [PubMed] [Google Scholar] 60. Хуанг Х., Manton KG. Роль окислительного повреждения митохондрий при старении: обзор. Передние биоски. 2004 Май; 9: 1100–1117. [PubMed] [Google Scholar] 61. Логан AC, Вонг С. Синдром хронической усталости: окислительный стресс и диетические модификации. Альтернативная медицина Rev.2001. 6 (5): 450–459. [PubMed] [Google Scholar] 62. Мануэль и Киной Б., Муркенс Г., Вертоммен Дж., Де Лиу И. Антиоксидантный статус и перекисное окисление липопротеинов при синдроме хронической усталости. Life Sci. 2001. 68 (17): 2037–2049. [PubMed] [Google Scholar] 63. Ричардс Р.С., Робертс Т.К., МакГрегор Н.Р., Данстан Р.Х., Батт Х.Л. Параметры крови, указывающие на окислительный стресс, связаны с выражением симптомов синдрома хронической усталости. Redox Rep. 2000; 5 (1): 35–41. [PubMed] [Google Scholar] 64. Fulle S, Mecocci P, Fano G и др.Специфические окислительные изменения в мышце широкой мышцы бедра у пациентов с диагнозом синдрома хронической усталости. Free Radic Biol Med. 2000. 29 (12): 1252–1259. [PubMed] [Google Scholar] 65. Pall ML. Повышенный и устойчивый уровень пероксинитрита как причина синдрома хронической усталости. Мед-гипотезы. 2000. 54 (1): 115–125. [PubMed] [Google Scholar] 66. Димауро С., Растин П. Критический подход к терапии митохондриальной респираторной цепи и заболеваний окислительного фосфорилирования. Biochim Biophys Acta.2009. 1792 (12): 1159–1167. [PubMed] [Google Scholar] 67. Chambers D, Bagnall AM, Hempel S, Forbes C. Вмешательства для управления лечением и реабилитации пациентов с синдромом хронической усталости / миалгическим энцепталомиелитом: обновленный систематический обзор. JR Soc Med. 2006. 99 (10): 506–520. [Бесплатная статья PMC] [PubMed] [Google Scholar] 68. Смит А.Р., Шенви С.В., Видлански М., Сух Дж. Х., Хаген TM. Липоевая кислота как потенциальная терапия хронических заболеваний, связанных с окислительным стрессом. Curr Med Chem. 2004. 11 (9): 1135–1146.[PubMed] [Google Scholar] 69. Мацзурек А., Хагер К., Кенклис М. и др. Липоевая кислота как противовоспалительное и нейрозащитное средство при болезни Альцгеймера. Adv Drug Deliv Rev. 2008; 60 (13–14): 1463–1470. [PubMed] [Google Scholar] 70. Шей К.П., Моро Р.Ф., Смит Э.Дж., Смит А.Р., Хаген TM. Альфа-липоевая кислота как пищевая добавка: молекулярные механизмы и терапевтический потенциал. Biochim Biophys Acta. 2009. 1790 (10): 1149–1160. [Бесплатная статья PMC] [PubMed] [Google Scholar] 71. Хенриксен Э.Дж., Джейкоб С., Стрипер Р.С., Фогт Д.Л., Хокама Д.Ю., Тритчлер Х.Дж.Стимуляция альфа-липоевой кислотой транспортной активности глюкозы в скелетных мышцах худых и тучных крыс Zucker. Life Sci. 1997. 61 (8): 805–812. [PubMed] [Google Scholar] 72. Гудзь Т.И., Цернг К.Ю., Хоппель К.Л. Прямое ингибирование комплекса III дыхательной цепи митохондрий проницаемым для клеток церамидом. J Biol Chem. 1997. 272 ​​(39): 24154–24158. [PubMed] [Google Scholar] 73. Ди Паола М., Кокко Т., Лоруссо М. Взаимодействие церамидов с дыхательной цепью митохондрий сердца. Биохимия. 2000. 39 (22): 6660–6668.[PubMed] [Google Scholar] 74. Монетт Дж. С., Гомес Л. А., Моро Р. Ф. и др. Обработка (R) -α-липоевой кислотой восстанавливает баланс церамидов в сердечных митохондриях стареющих крыс. Pharmacol Res. 2011; 63 (1): 23–29. [Бесплатная статья PMC] [PubMed] [Google Scholar] 75. Зиглер Д., Новак Х., Кемплер П., Варга П., Лоу ПА. Лечение симптоматической диабетической полинейропатии антиоксидантом альфа-липоевой кислотой: метаанализ. Diabet Med. 2004. 21 (2): 114–121. [PubMed] [Google Scholar] 76. Ziegler D, Low PA, Litchy WJ, et al. Эффективность и безопасность антиоксидантной терапии α-липоевой кислотой в течение 4 лет при диабетической полинейропатии: исследование NATHAN 1.Уход за диабетом. 2011. 34 (9): 2054–2060. [Бесплатная статья PMC] [PubMed] [Google Scholar] 77. Йошида К., Хирокава Дж., Тагами С., Каваками Ю., Урата Ю., Кондо Т. Ослабленная активность клеток по нейтрализации окислительного стресса при сахарном диабете: регулирование синтеза и оттока глутатиона. Диабетология. 1995. 38 (2): 201–210. [PubMed] [Google Scholar] 78. Горача А., Хук-Колега Х., Пехота А., Кленевска П., Цейка Э., Скибска Б. Липоевая кислота — биологическая активность и терапевтический потенциал. Pharmacol Rep. 2011; 63 (4): 849–858.[PubMed] [Google Scholar] 79. Глава Е, Нукала В.Н., Феноглио К.А., Муггенбург Б.А., Котман К.В., Салливан П.Г. Влияние возраста, диетического и поведенческого обогащения на митохондрии мозга на собачьей модели старения человека. Exp Neurol. 2009. 220 (1): 171–176. [Бесплатная статья PMC] [PubMed] [Google Scholar] 80. Марковина С.М., Сиртори С., Перачино А. и др. Перевод базовых знаний о митохондриальных функциях в метаболическую терапию: роль L-карнитина. Перевод Рез. 2013. 161 (2): 73–84. [Бесплатная статья PMC] [PubMed] [Google Scholar] 81.Reuter SE, Evans AM. Карнитин и ацилкарнитины: фармакокинетические, фармакологические и клинические аспекты. Клин Фармакокинет. 2012. 51 (9): 553–572. [PubMed] [Google Scholar] 82. Newgard CB, An J, Bain JR и др. Метаболическая характеристика, связанная с аминокислотами с разветвленной цепью, которая отличает людей с ожирением от худощавых и способствует развитию инсулинорезистентности. Cell Metab. 2009. 9 (4): 311–326. [Бесплатная статья PMC] [PubMed] [Google Scholar] 83. Ковес Т.Р., Ашер Дж.Р., Ноланд Р.К. и др. Перегрузка митохондрий и неполное окисление жирных кислот способствуют развитию инсулинорезистентности скелетных мышц.Cell Metab. 2008. 7 (1): 45–56. [PubMed] [Google Scholar] 84. Shah SH, Hauser ER, Bain JR, et al. Высокая наследуемость метаболомных профилей в семьях с преждевременным сердечно-сосудистым заболеванием. Mol Syst Biol. 2009; 5: 258. DOI: 10.1038 / msb.2009.11. [Бесплатная статья PMC] [PubMed] [Google Scholar] 85. Сприт Л.Л., Перри К.Г., Таланян Дж.Л. Допустимые пищевые добавки перед соревнованиями для улучшения энергетического обмена. Очерки Биохимии. 2008; 44: 27–43. [PubMed] [Google Scholar] 86. Латунь EP. Дополнительный карнитин и упражнения.Am J Clin Nutr. 2000; 72 (2) доп .: 618S – 623S. [PubMed] [Google Scholar] 87. Вахтер С., Фогт М., Крейс Р. и др. Длительное введение L-карнитина людям: влияние на содержание карнитина в скелетных мышцах и физическую работоспособность. Clin Chim Acta. 2002. 318 (1-2): 51–61. [PubMed] [Google Scholar] 88. Ананд I, Чандрашехан Й., Де Джули Ф. и др. Острые и хронические эффекты пропионил-L-карнитина на гемодинамику, работоспособность и гормоны у пациентов с застойной сердечной недостаточностью. Кардиоваск наркотики Ther.1998. 12 (3): 291–299. [PubMed] [Google Scholar] 89. Hagen TM, Moreau R, Suh JH, Visioli F. Митохондриальный распад в стареющем сердце крысы: доказательства улучшения за счет пищевых добавок с ацетил-L-карнитином и / или липоевой кислотой. Ann NY Acad Sci. 2002 апр; 959: 491–507. [PubMed] [Google Scholar] 91. Malaguarnera M, Cammalleri L, Gargante MP, Vacante M, Colonna V, Motta M. Лечение L-карнитином снижает степень физической и умственной усталости и увеличивает когнитивные функции у долгожителей: рандомизированное и контролируемое клиническое исследование.Am J Clin Nutr. 2007. 86 (6): 1738–1744. [PubMed] [Google Scholar] 92. Литтарру Г.П., Тиано Л. Клинические аспекты коэнзима Q10: обновленная информация. Питание. 2010. 26 (3): 250–254. [PubMed] [Google Scholar] 93. Гронеберг Д.А., Киндерманн Б., Альтхаммер М. и др. Коэнзим Q10 влияет на экспрессию генов, участвующих в передаче сигналов, метаболизме и транспорте в клетках CaCo-2. Int J Biochem Cell Biol. 2005. 37 (6): 1208–1218. [PubMed] [Google Scholar] 94. Orsucci D, Mancuso M, Ienco EC, LoGerfo A, Siciliano G. Нацеливание на митохондриальную дисфункцию и нейродегенерацию с помощью коэнзима Q10 и его аналогов.Curr Med Chem. 2011. 18 (26): 4053–4064. [PubMed] [Google Scholar] 95. Розенфельдт Ф., Хилтон Д., Пепе С., Крам Х. Систематический обзор эффекта коэнзима Q10 при физических упражнениях, гипертонии и сердечной недостаточности. Биофакторы. 2003. 18 (1–4): 91–100. [PubMed] [Google Scholar] 96. Мизуно К., Танака М., Нозаки С. и др. Эффекты утомляемости коэнзима Q10 при физической усталости. Питание. 2008. 24 (4): 293–299. [PubMed] [Google Scholar] 97. Ли Джи, Джек CR, Ян XF, Ян ES. Пищевая добавка CoQ10 задерживает атрофию мозга у старых трансгенных мышей с мутациями в белке-предшественнике амилоида: исследование in vivo на объемной МРТ .Биофакторы. 2008. 32 (1–4): 169–178. [PubMed] [Google Scholar] 98. Ян X, Дай Г, Ли Г, Ян ES. Коэнзим Q10 снижает бета-амилоидные бляшки в модели болезни Альцгеймера у трансгенных мышей APP / PS1. J Mol Neurosci. 2010. 41 (1): 110–113. [PubMed] [Google Scholar] 99. Галаско Д.Р., Пескинд Э., Кларк С.М. и др. Совместное исследование болезни Альцгеймера. Антиоксиданты при болезни Альцгеймера: рандомизированное клиническое испытание с измерением биомаркеров спинномозговой жидкости. Arch Neurol. 2012. 69 (7): 836–841. [Бесплатная статья PMC] [PubMed] [Google Scholar] 100.Isobe C, Abe T, Terayama Y. Уровни восстановленного и окисленного кофермента Q10 и 8-гидрокси-2′-дезоксигуанозина в спинномозговой жидкости у пациентов с болезнью Паркинсона при жизни демонстрируют, что окислительное повреждение митохондрий и / или окислительное повреждение ДНК способствует нейродегенеративному процессу. процесс. Neurosci Lett. 2010. 469 (1): 159–163. [PubMed] [Google Scholar] 101. Группа изучения Хантингтона. Рандомизированное плацебо-контролируемое исследование коэнзима Q10 и ремасемида при болезни Хантингтона. Неврология. 2001. 57 (3): 397–404.[PubMed] [Google Scholar] 102. Кауфманн П., Томпсон Дж. Л., Леви Г. и др. Исследовательская группа QALS. Испытание фазы II CoQ10 для лечения БАС не нашло достаточных доказательств для обоснования фазы III. Энн Нейрол. 2009. 66 (2): 235–244. [Бесплатная статья PMC] [PubMed] [Google Scholar] 103. Мэтьюз П.М., Форд Б., Дандуранд Р.Дж. и др. Коэнзим Q10 с множеством витаминов обычно неэффективен при лечении митохондриальных заболеваний. Неврология. 1993. 43 (5): 884–890. [PubMed] [Google Scholar] 104. Penberthy WT. Никотинамид-аденин-динуклеотид — биология и болезнь.Curr Pharm Des. 2009; 15 (1): 1-2. [PubMed] [Google Scholar] 105. Киркланд JB. Статус ниацина, распределение НАД и метаболизм АДФ-рибозы. Curr Pharm Des. 2009. 15 (1): 3–11. [PubMed] [Google Scholar] 106. Birkmayer JG. Коэнзим никотинамида адениндинуклеотид: новый терапевтический подход для улучшения деменции типа Альцгеймера. Ann Clin Lab Sci. 1996; 26 (1): 1–9. [PubMed] [Google Scholar] 107. Райнер М, Краксбергер Э, Хаусхофер М, Маке Х.А., Джеллингер К.А. Нет доказательств улучшения когнитивных функций от перорального приема никотинамидадениндинуклеотида (НАДН) при деменции.J Neural Transm. 2000. 107 (12): 1475–1481. [PubMed] [Google Scholar] 108. Демарин В., Подобник С.С., Сторга-Томич Д., Кей Г. Лечение болезни Альцгеймера стабилизированным пероральным никотинамид-адениндинуклеотидом: рандомизированное двойное слепое исследование. Препараты Exp Clin Res. 2004. 30 (1): 27–33. [PubMed] [Google Scholar] 109. Birkmayer JG, Vrecko C, Volc D, Birkmayer W. Никотинамид адениндинуклеотид (NADH) — новый терапевтический подход к болезни Паркинсона: сравнение перорального и парентерального применения. Acta Neurol Scand Suppl.1993. 146: 32–35. [PubMed] [Google Scholar] 110. Диздар Н., Кагедал Б., Линдвалл Б. Лечение болезни Паркинсона с помощью НАДН. Acta Neurol Scand. 1994. 90 (5): 345–347. [PubMed] [Google Scholar] 111. Форсайт Л. М., Пройс Г. Г., МакДауэлл А. Л., Кьяцце Л. Младший, Биркмайер Г. Д., Белланти Д. А.. Терапевтические эффекты перорального НАДН на симптомы у пациентов с синдромом хронической усталости. Ann Allergy Asthma Immunol. 1999. 82 (2): 185–191. [PubMed] [Google Scholar] 112. Colquhoun D, ​​Senn S. Эффективен ли НАДН при лечении синдрома хронической усталости? Ann Allergy Asthma Immunol.2000. 84 (6): 639–640. [PubMed] [Google Scholar] 113. Santaella ML, шрифт I, Disdier OM. Сравнение перорального приема никотинамидадениндинуклеотида (НАДН) с традиционной терапией синдрома хронической усталости. P R Health Sci J. 2004; 23 (2): 89–93. [PubMed] [Google Scholar] 114. Алегре Дж., Розес Дж. М., Хавьер С., Руис-Бакес А., Сегундо М. Дж., Де Севилья Т. Ф. Никотинамидадениндинуклеотид (НАДН) у пациентов с синдромом хронической усталости [на испанском языке] Rev Clin Esp. 2010. 210 (6): 284–288. [PubMed] [Google Scholar] 115.Николсон ГЛ. Замещение липидов в качестве дополнения к терапии хронической усталости, против старения и восстановления митохондриальной функции. J Am Nutraceutical Assoc. 2003. 6 (3): 22–28. [Google Scholar] 116. Николсон Г.Л., Эллиторп Р. Замещение липидов и антиоксидантная нутритивная терапия для восстановления функции митохондрий и снижения утомляемости при синдроме хронической усталости и других утомляющих заболеваниях. J Syndr. Хронической усталости. 2006. 13 (1): 57–68. [Google Scholar] 117. Эллиторп Р.Р., Сеттинери Р.А., Николсон Г.Л. Экспериментальное исследование: снижение утомляемости за счет применения пищевой добавки, содержащей гликофосфолипиды.J Am Nutraceutical Assoc. 2003. 6 (1): 23–28. [Google Scholar] 118. Nicolson GL, Ellithorpe RR, Ayson-Mitchell C, Jacques B, Settineri R. Заместительная липидная терапия с применением гликофосфолипид-антиоксидантно-витаминной композиции значительно снижает утомляемость в течение одной недели. J Am Nutraceutical Assoc. 2010. 13 (1): 10–14. [Google Scholar] 119. Николсон Г.Л., Сеттинери Р., Эллиторп Р. Заместительная липидная терапия с использованием гликофосфолипидного состава с НАДН и CoQ10 значительно снижает утомляемость у трудноизлечимых хронических утомительных заболеваний и пациентов с хронической болезнью Лайма.Int J Clin Med. 2012. 3 (3): 163–170. [Google Scholar] 120. Nicolson GL, Settineri R, Ellithorpe R. Состав гликофосфолипида с NADH и CoQ10 значительно снижает трудноизлечимое утомление у пациентов с хронической болезнью Лайма, положительных по Вестерн-блоттингу: предварительный отчет. Funct Foods Health Dis. 2012. 2 (3): 35–47. [Google Scholar]

Дисфункция митохондрий и хронические заболевания: лечение натуральными добавками

Integr Med (Encinitas). 2014 Август; 13 (4): 35–43.

Основатель, президент и профессор-исследователь кафедры молекулярной патологии Института молекулярной медицины в Хантингтон-Бич, Калифорния.

Copyright © 2014 InnoVision Professional MediaЭта статья цитируется в других статьях PMC.

Abstract

Потеря функции митохондрий, ключевой органеллы, ответственной за выработку клеточной энергии, может привести к чрезмерной утомляемости и другим симптомам, которые являются обычными жалобами почти при каждом хроническом заболевании. На молекулярном уровне снижение функции митохондрий происходит в результате следующих изменений: (1) потеря поддержания электрического и химического трансмембранного потенциала внутренней митохондриальной мембраны, (2) изменение функции транспорта электронов. цепи, или (3) снижение транспорта критических метаболитов в митохондрии.В свою очередь, эти изменения приводят к снижению эффективности окислительного фосфорилирования и снижению выработки аденозин-5′-трифосфата (АТФ). Некоторые компоненты этой системы требуют регулярной замены, и эту потребность можно облегчить с помощью натуральных добавок. Клинические испытания показали полезность использования пероральных замещающих добавок, таких как l-карнитин, альфа-липоевая кислота (α-липоевая кислота [1,2-дитиолан-3-пентановая кислота]), кофермент Q 10 (CoQ 10). [убихинон]), восстановленный никотинамидадениндинуклеотид (НАДН), мембранные фосфолипиды и другие добавки.Комбинации этих добавок могут значительно снизить утомляемость и другие симптомы, связанные с хроническими заболеваниями, и могут естественным образом восстановить функцию митохондрий даже у длительно длительных пациентов с трудноизлечимой усталостью.

Митохондриальная дисфункция, характеризующаяся потерей эффективности в цепи переноса электронов и снижением синтеза высокоэнергетических молекул, таких как аденозин-5′-трифосфат (АТФ), является признаком старения и, по сути, всего хронические болезни.1–4 Эти заболевания включают нейродегенеративные заболевания, такие как болезнь Альцгеймера, болезнь Паркинсона, болезнь Хантингтона, боковой амиотрофический склероз и атаксия Фридрейха1,2,4,5; сердечно-сосудистые заболевания, такие как атеросклероз и другие сердечные и сосудистые заболевания6,7; диабет и метаболический синдром8–10; аутоиммунные заболевания, такие как рассеянный склероз, системная красная волчанка и диабет 1 типа11–14; нейроповеденческие и психические заболевания, такие как расстройства аутистического спектра, шизофрения, биполярные расстройства и расстройства настроения15-19; желудочно-кишечные расстройства20,21; утомляющие болезни, такие как синдром хронической усталости и болезни, вызванные войной в Персидском заливе22–24; заболевания опорно-двигательного аппарата, такие как фибромиалгия и гипертрофия / атрофия скелетных мышц25–27; рак28,29; и хронические инфекции.30,31

Исследователям хорошо известно, что митохондриальные генетические или первичные митохондриальные нарушения способствуют митохондриальной дисфункции и вторичным или приобретенным дегенеративным нарушениям.32 Этот обзор будет сосредоточен на негенетических или приобретенных механизмах, которые могли бы объяснить митохондриальную дисфункцию и их заместительное лечение естественными добавки и комбинации натуральных добавок, включая витамины, минералы, кофакторы ферментов, антиоксиданты, метаболиты, переносчики, фосфолипиды мембранного типа и другие натуральные добавки.

Митохондриальная молекулярная дисфункция

Митохондриальная дисфункция возникает из-за недостаточного количества митохондрий, неспособности обеспечить митохондрии необходимыми субстратами или дисфункции их механизмов транспорта электронов и синтеза АТФ. Число и функциональный статус митохондрий в клетке можно изменить путем (1) слияния частично дисфункциональных митохондрий и смешивания их неповрежденных компонентов для улучшения общей функции, (2) генерации совершенно новых митохондрий (деление) и (3) удаление и полная деградация дисфункциональных митохондрий (митофагия).33 Эти события контролируются сложными клеточными процессами, которые определяют ухудшение митохондрий, например деполяризацию митохондриальных мембран или активацию определенных путей транскрипции. 34,35

Способность клеток производить почти все высокоэнергетические молекулы, такие как АТФ напрямую связан со способностью митохондрий (1) преобразовывать энергию метаболитов в восстановленный никотинамидадениндинуклеотид (НАДН) и (2) переносить электроны от НАДН к цепи переноса электронов и, в конечном итоге, к молекулярному кислороду, перекачивая протоны из митохондрий. матрикс через внутреннюю митохондриальную мембрану в межмембранное пространство.Этот процесс создает трансмембранный протонный градиент (Δp) и электрохимический градиент (Δψ m ) на внутренней мембране митохондрий.36,37 Трансмембранный потенциал, создаваемый протонным градиентом, затем использует АТФ-синтазу для протекания протонов обратно через внутреннюю митохондриальную мембрану. и использует энергию этого процесса для стимулирования фосфорилирования аденозиндифосфата (АДФ) до АТФ.36,38

Следствием процесса переноса электронов является производство активных форм кислорода (АФК), высокоактивных свободных радикалов, которые образуются как побочный продукт окислительного фосфорилирования.Основными источниками АФК и связанных с ними активных форм азота (РНС) являются митохондрии, и эти свободные радикалы могут повреждать клеточные липиды, белки и ДНК.39–41. Однако некоторые механизмы могут нейтрализовать АФК / РНС; Ферменты дисмутазы и антиоксиданты могут контролировать избыточное количество ROS / RNS.42,43 Помимо создания ROS / RNS, процесс переноса электронов может вызывать разобщение белков, что приводит к контролируемой утечке протонов обратно через протонный градиент внутренней митохондрии. мембраны в митохондриальный матрикс.36,37 Эта утечка приводит к снижению выработки АТФ, в то время как он все еще потребляет избыточный кислород. 43

В присутствии контролируемой утечки протонов избыточное потребление кислорода и, как следствие, производство ROS может привести к несоответствующему повреждению липидов митохондриальной мембраны, 41,42 таких как очень чувствительный к АФК / РНС кардиолипин, фосфолипид внутренней митохондриальной мембраны.44 Окислительное повреждение кардиолипина и других мембранных фосфолипидов во внутренней митохондриальной мембране может привести к увеличению утечки протонов и ионов обратно через внутреннюю мембрану в матрикс митохондрий и частичная потеря электрохимического градиента.Кардиолипин также является важным компонентом цепи переноса электронов, обеспечивая стабильность комплексов цитохром / фермент во внутренней митохондриальной мембране.44 При неблагоприятном повреждении ROS / RNS окисленный кардиолипин вызывает потерю функции транспорта электронов.45

Клеточный антиоксидант Защитные механизмы обычно поддерживают уровни ROS / RNS в концентрациях, которые предотвращают избыточное окисление клеточных молекул. 46–48 Клеточная антиоксидантная защита, которая является эндогенной, опосредуется глутатионпероксидазой, каталазой и супероксиддисмутазой, среди других ферментов.48,49 Кроме того, некоторые диетические антиоксиданты с низкой молекулярной массой могут влиять на антиоксидантный статус.50,51 Некоторые из этих диетических антиоксидантов использовались в качестве естественных профилактических средств для снижения избыточных концентраций окислительных молекул до физиологических уровней, которые могут поддерживаться за счет эндогенные антиоксидантные системы.52

Митохондриальная дисфункция и усталость

Митохондриальная дисфункция напрямую связана с избыточной утомляемостью. Усталость считается многомерным ощущением, которое воспринимается как потеря общей энергии и неспособность выполнять даже простые задачи без напряжения.53,54 Хотя легкая усталость может быть вызвана рядом состояний, включая депрессию и другие психологические состояния, умеренная и тяжелая усталость затрагивает энергетические системы клеток. 53,54 На клеточном уровне умеренная или тяжелая усталость связана с потерей функции митохондрий. и снижение выработки АТФ.54–56 Неизлечимая усталость, продолжающаяся более 6 месяцев, которая не снимается сном (хроническая усталость), является наиболее частой жалобой пациентов, обращающихся за общей медицинской помощью.53,57 Хроническая усталость также является важным вторичным состоянием при лечении. многие клинические диагнозы, часто предшествующие первичному диагнозу пациента.57,58

В результате старения и хронических заболеваний окислительное повреждение митохондриальных мембран нарушает функцию митохондрий.59–61 Например, люди с синдромом хронической усталости имеют признаки окислительного повреждения ДНК и липидов, 61,62 таких в виде маркеров окисленной крови63 и окисленных липидов мембран 64, что указывает на избыточный окислительный стресс. У этих людей также наблюдается устойчивый повышенный уровень пероксинитрита, вызванный избытком оксида азота, что также может привести к перекисному окислению липидов и потере функции митохондрий, а также к изменениям уровней цитокинов, которые оказывают положительную обратную связь на производство оксида азота.65

Натуральные добавки и митохондриальная дисфункция

Ряд натуральных добавок использовался для лечения непсихологической усталости и митохондриальной дисфункции.32,54,66 Эти добавки включают добавки, содержащие витамины, минералы, антиоксиданты, метаболиты, ингибиторы ферментов и кофакторы митохондрий. транспортеры, травы и мембранные фосфолипиды (32) .Хотя несколько натуральных добавок использовались для снижения утомляемости, лишь немногие из них считаются действительно эффективными.67 В этой статье будут рассмотрены некоторые из наиболее многообещающих добавок, а в заключении будут рассмотрены комбинации конкретных добавок, которые использовались. для лечения трудноизлечимой хронической усталости и улучшения функции митохондрий.

Таблица 1

Неполный список ингредиентов / агентов, которые практикующие врачи использовали или предлагали для лечения митохондриальной дисфункции a

ингибиторы

900 55

Категория Примеры
Витамины Витамины C, D и E, тиамин, рибофлавин
Минералы Магний, кальций, фосфат
Липиды Мембранные фосфолипиды, ненасыщенные жирные кислоты
Метаболиты Креатин, пируват
Кофакторы 10 , α-липоевая кислота, НАДН, никотиновая кислота
Транспортеры l-карнитин, мембранные фосфолипиды
Антиоксиданты CoQ 10 , α-липоевая кислота, НАДН, глутатион
α-липоевая кислота, дихлорацетат
Травы Куркумин, схизандрин

α-липоевая кислота

Альфа-липоевая кислота (α-липоевая кислота [1,2-дитиолан-3-пентановая кислота]) является мощным антиоксидантом, хелатором переходных металлов. , редокс-регулятор транскрипции и противовоспалительное средство.68 Он действует как критический кофактор в митохондриальных дегидрогеназах α-кетокислот и, таким образом, играет важную роль в митохондриальных реакциях окислительно-декарбоксилирования.69,70 Клинически α-липоевая кислота использовалась в качестве пероральной добавки при лечении связанных с ней осложнений. с сахарным диабетом, и, согласно обзору Шэя и др., 70 было показано, что он способствует улучшению различных нейропатий, связанных с диабетом, воспалений и здоровья сосудов. В модельных клеточных системах эти эффекты приписывались главным образом α-липоевой кислоте, обладающей эффектами передачи сигнала на регуляцию генов, а также на поглощение и метаболизм глюкозы, а также на ее антиоксидантные эффекты.71

В результате старения и многих хронических заболеваний определенные сфинголипиды — особенно церамиды и, в частности, короткоцепочечные церамиды — накапливаются в митохондриях из-за гидролиза сфингомиелина сфингомиелиназой, и в конечном итоге это накопление замедляет активность транспорта электронов. 72,73 Накопление церамидов в митохондриях особенно опасно для сердечной ткани. У стареющих грызунов α-липоевая кислота использовалась для снижения уровней церамидов в эндотелиальных клетках сосудов сердечной мышцы за счет ингибирования активности сфингомиелиназы, что приводило к восстановлению уровней митохондриального глутатиона и увеличению функции транспорта электронов.74

Как упоминалось выше, при диабете α-липоевая кислота широко используется для уменьшения диабетических осложнений, таких как сенсомоторные полинейропатии.75 Одно 4-летнее слепое исследование продемонстрировало, что некоторые невропатические нарушения значительно улучшились на α-липоевой кислоте (но не атрибуты нервной проводимости), демонстрируя клиническую полезность антиоксиданта и безопасность длительного лечения α-липоевой кислотой для пациентов с диабетом.76

В качестве пероральной добавки α-липоевая кислота редко присутствует в тканях выше микромолярных уровней; таким образом, маловероятно, что он будет непосредственно задействован в качестве важного первичного клеточного антиоксиданта.70 Однако его способность повышать уровень клеточного глутатиона является важным антиоксидантным свойством, и это повышение достигается за счет регулирования синтеза глутатиона и, таким образом, уменьшения окислительного стресса.77 Этот антиоксидант может влиять на регуляцию ядерного фактора транскрипции NF-κΒ, и, таким образом, , он может вызывать широко распространенные транскрипционные эффекты, приводящие к ослаблению выработки свободных радикалов и цитотоксических цитокинов.78

Как хелатор переходных металлов, α-липоевая кислота может удалять избыток меди, железа и других металлов, которые участвуют в хронических заболеваниях. , таких как гемохроматоз, терминальная стадия почечной недостаточности и болезни Альцгеймера и Паркинсона, и он является потенциальным терапевтическим средством для предотвращения или смягчения отравлений тяжелыми металлами.68 Он также улучшает когнитивные функции и функцию митохондрий, предполагая связь между окислительным повреждением митохондрий и когнитивными функциями.79 Использование α-липоевой кислоты при хронической усталости еще не изучалось в контролируемых клинических испытаниях, но ее широкое распространение в качестве безопасной добавки (обычно 200-600 мг / сут) 70 для поддержки функции митохондрий и снижения окислительного стресса оправдало его включение в различные смеси добавок 70,76,78

l-карнитин

l-карнитин (3-гидрокси-4- -триметиламинобутират) представляет собой естественный переносчик жирных кислот, обнаруживаемый у всех видов млекопитающих.Он непосредственно участвует в транспорте жирных кислот в матрикс митохондрий для последующего β-окисления, но он также действует в удалении избыточных ацильных групп из организма и в модуляции гомеостатаза внутриклеточного кофермента A (CoA )80,81. из-за его важности в окислении жирных кислот и гомеостатазе КоА и ацил-КоА, l-карнитин обычно поддерживается в относительно узких пределах концентрации; таким образом, диетические добавки важны для поддержания необязательных концентраций l-карнитина в клетках.81 Действительно, нарушения, связанные с дефицитом l-карнитина, связаны со снижением функции митохондрий, инсулинорезистентностью и ишемической болезнью сердца. 82–84

Важная роль l-карнитина в митохондриальном метаболизме стимулировала использование добавок l-карнитина для потенциально улучшения физическая работоспособность.85 Обоснование этого состоит в том, что повышенная зависимость от жира в качестве основного субстрата для производства энергии во время экстремальных упражнений должна снизить потребность в углеводах и замедлить истощение запасов углеводов, и что эти изменения должны увеличить общую выработку энергии и снизить утомляемость, вызванную физическими упражнениями. .Транспортировка жирных кислот в митохондрии также требует повышенных уровней l-карнитина и, таким образом, указывает на необходимость пищевых добавок l-карнитина. Однако исследования показали, что увеличение количества пероральных добавок l-карнитина, даже за 2-3 недели до экстремальных упражнений, не приводит к увеличению содержания карнитина в скелетных мышцах. Следовательно, маловероятно, что эта добавка изменяет метаболизм мышц во время экстремальных упражнений. 86,87

Добавка с l-карнитином успешно используется при клинических заболеваниях, которые характеризуются низкими концентрациями l-карнитина или нарушением окисления жирных кислот, таких как диабет. , сепсис, почечная недостаточность и кардиомиопатия.80 Например, в небольшом исследовании с участием 18 человек с застойной сердечной недостаточностью и 12 человек из контрольной группы плацебо добавление пропионил-1-карнитина приводило к увеличению пиковой частоты сердечных сокращений (в среднем 12%), переносимости физических нагрузок (в среднем 21%) и максимальной частоты сердечных сокращений. потребление кислорода (в среднем 45%) в группе лечения.88

Важным средством против старения l-карнитина было увеличение скорости митохондриального окислительного фосфорилирования, которое естественным образом снижается в результате старения. Это снижение снижает производство энергии, но увеличивает производство ROS / RNS.Было обнаружено, что кормление старыми крысами ацетил-1-карнитином обращает вспять возрастное снижение уровня l-карнитина, одновременно увеличивая метаболизм жирных кислот. Он также обратил вспять возрастное снижение уровня клеточного глутатиона и улучшил активность комплекса IV митохондрий мышц.89

Хотя диетические добавки с l-карнитином и его различными производными представляются безопасными (дозы до 2 г / день) 90 и потенциально полезный для увеличения функции митохондрий, исследователи не провели необходимых множественных клинических испытаний, чтобы показать его эффективность при большинстве хронических заболеваний, связанных с возрастом (кроме диабета и сердечно-сосудистых заболеваний).Единственным исключением было рандомизированное контролируемое клиническое исследование с участием 70 долгожителей, получавших l-карнитин в течение 6 месяцев. У этих участников обычно обнаруживалась мышечная слабость, ухудшение психического здоровья, нарушение подвижности и плохая выносливость. К концу исследования в группе, получавшей лечение, наблюдались значительные улучшения в плане физической усталости, умственной утомляемости и тяжести утомляемости. Они также показали снижение общей жировой массы, увеличение мышечной массы и повышение способности к физической и когнитивной активности за счет снижения утомляемости и улучшения когнитивных функций.91 Другие исследования алкоголизма, печеночной энцефалопатии, ишемической болезни сердца, болезни Пейрони, церебральной ишемии и бесплодия показали, что введение l-карнитина может оказывать положительное влияние на признаки и симптомы этих состояний. 90

Коэнзим Q

10

Коэнзим Q 10 (CoQ 10 [убихинон]) является ключевым кофактором и компонентом митохондриальной цепи переноса электронов и одной из наиболее широко используемых природных добавок.32,92 Он также является сильным антиоксидантом в его восстановленной форме. и это может влиять на экспрессию определенных генов, участвующих в передаче сигналов, метаболизме и транспорте клеток.92,93 Однако основная роль CoQ 10 заключается в его участии в переносе электронов по множественным комплексам митохондриальной цепи переноса электронов.92,94 Клинически он использовался в дозах до 1200 мг в день, но в большинстве исследований использовались более низкие дозы.92

Поскольку CoQ 10 является важным компонентом митохондриальной системы окислительного фосфорилирования, его добавление к людям с пониженными уровнями должно приводить к увеличению выработки энергии и снижению утомляемости.92,94 Систематический обзор эффектов CoQ 10 при физических упражнениях, гипертонии и сердечной недостаточности, проведенный Розенфельдтом и соавторами 95, показал, что 6 из 11 опубликованных исследований показали умеренное улучшение переносимости упражнений у участников, получавших CoQ 10 с пищей. . В 8 исследованиях, в которых изучалось влияние CoQ 10 на гипертонию, наблюдалось среднее снижение артериального давления: систолическое, среднее снижение на 16 мм рт. и диастолическое, среднее снижение на 10 мм рт. В обзоре 9 рандомизированных испытаний, в которых изучалось использование CoQ 10 у участников с сердечной недостаточностью, показали незначительные тенденции к увеличению фракции инъекций и снижению смертности.Rosenfeldt et al95 провели собственное трехмесячное рандомизированное плацебо-контролируемое исследование эффектов перорального приема CoQ 10 у 35 пациентов с сердечной недостаточностью и обнаружили, что участники группы CoQ 10 , но не контрольной группы, показали значительное улучшение симптомов.95 Исследование также показало тенденцию к улучшению средней продолжительности упражнений.95

Также изучались эффекты перорального приема CoQ 10 во время физических упражнений. В слепом перекрестном исследовании 17 здоровых участников получали CoQ 10 или плацебо в течение 8 дней, а затем их работоспособность оценивалась дважды при фиксированных нагрузках на велоэргометре в течение 2 часов с 4-часовым отдыхом между тестами.96 Участники, принимавшие CoQ 10 , смогли достичь более высоких результатов работы и меньше ощущали усталость, и их потребность в периоде восстановления была уменьшена по сравнению с группой плацебо. 96

Клинически CoQ 10 использовался для уменьшения симптомы и прогрессирование различных нейродегенеративных заболеваний.92,94 В исследованиях с использованием моделей болезни Альцгеймера введение CoQ 10 значительно замедляло атрофию мозга и типичную патологию β-амилоидных бляшек.97,98 В рандомизированном, плацебо-контролируемом, 16-недельном исследовании. В клиническом испытании 98 участников с болезнью Альцгеймера, которые принимали пероральную смесь CoQ 10 , витаминов C и E и α-липоевой кислоты, группа испытаний показала значительное снижение маркеров оксидативного стресса, но не показала значительных изменений в спинномозговой жидкости (CSF). ) маркеры, относящиеся к патологии β-амилоида или тау.99

При болезни Паркинсона у людей, как правило, наблюдается повышенное соотношение окисленного CoQ к общему количеству 10 и значительное увеличение маркеров окислительного повреждения в спинномозговой жидкости, которое можно частично обратить вспять с помощью введения CoQ 10 100. Болезнь Хантингтона, исследование Huntington Study Group показало, что прием CoQ 10 в течение 30 месяцев замедлял обычное снижение общей функциональной способности, но различия не достигли статистической значимости.101 Наконец, в многоцентровом плацебо-контролируемом исследовании фазы II с участием пациентов с боковым амиотрофическим склерозом CoQ 10 существенно не повлиял на функциональное снижение за 9-месячный период, 102 и Мэтьюз и др. 103 не обнаружили CoQ 10 . плюс несколько витаминов, которые будут эффективны у людей с генетическими митохондриальными заболеваниями.

Никотинамид-аденин-динуклеотид

НАДН действует как клеточный окислительно-восстановительный кофактор в более чем 200 клеточных окислительно-восстановительных реакциях и как субстрат для определенных ферментов.104,105 Люди повсеместно нуждаются в НАДН, и его дефицит приводит к пеллагре, которая характеризуется дерматитом, диареей, слабоумием и, в конечном итоге, смертью.104 В митохондриях НАДН доставляет электроны от гидролиза метаболитов в цепь переноса электронов, но в его восстановленной форме, он также может действовать как сильный антиоксидант. Обычный путь приема пищевых добавок исторически заключался в использовании предшественников НАДН, таких как ниацин, никотиновая кислота или никотинамид, но в последнее время для стабилизации перорального НАДН стали использовать микроносители, чтобы его можно было непосредственно проглатывать в небольших дозах и всасываться в желудочно-кишечной системе. .Эта добавка оказывается более эффективной, чем большие пероральные дозы НАДН, как в некоторых исследованиях, которые использовали до 50 мг / кг / день. При таком размере дозы НАДН склонен к окислению и деградации, и такие добавки обычно считаются неэффективными.106

При нейродегенеративных заболеваниях окислительное повреждение является обширным, 1,2 и для лечения заболевания используются различные митохондриальные антиоксиданты. и задерживают прогрессирование.1–6,32 Одно исследование показало, что при болезни Альцгеймера стабилизированный пероральный НАДН может улучшить когнитивные функции и деменцию106; однако другое клиническое испытание не показало никаких доказательств улучшения когнитивных функций или деменции при пероральном приеме НАДН.107 В контролируемом исследовании с 26 участниками с болезнью Альцгеймера, которым давали стабилизированный НАДН или плацебо в течение 6 месяцев, Дермин и др. 108 обнаружили, что тестовая группа имела значительно лучшие результаты, чем группа плацебо, по беглости речи и визуальному построению, и показала тенденцию к увеличению выступление на абстрактном словесном рассуждении. Тем не менее, исследование не предоставило доказательств лучшей эффективности в отношении показателей внимания или памяти или оценки степени тяжести деменции.

Стабилизированный пероральный НАДН также использовался для облегчения симптомов болезни Паркинсона.В предварительном открытом клиническом исследовании Birkmayer et al109 изучили эффекты внутривенного и перорального приема НАДН у более чем 800 человек с болезнью Паркинсона. Они обнаружили, что 19,3% участников показали снижение инвалидности от 30% до 50%; У 58,8% наблюдалось умеренное (10–30%) улучшение; и 21,8% не ответили на терапию ( P <0,01). Более молодые пациенты с более короткой продолжительностью заболевания имели гораздо больше шансов ответить и показать более значительные улучшения, чем пожилые пациенты или пациенты с более длительной продолжительностью заболевания.Пероральная форма была сопоставима с внутривенным введением НАДН по своим эффектам.109 Однако, когда они повторили этот тип исследования, Диздар и др. 110 не обнаружили статистически значимых улучшений в оценочных показателях болезни Паркинсона у участников, получавших НАДН, а также не было обнаружено различий в показателях оценки болезни Паркинсона. Клинические маркеры ЦСЖ, связанные с тяжестью болезни Паркинсона.

Стабилизированный пероральный НАДН также используется для уменьшения симптомов у пациентов с хронической усталостью. Одно из таких исследований с участием людей с синдромом хронической усталости было разработано для лечения участников стабилизированным пероральным НАДН или плацебо в течение 4 недель в перекрестном исследовании.111 Из этих участников 8 из 26 (30,7%) положительно ответили на микрокапсулированный НАДН по сравнению с 2 из 26 (8%) в группе плацебо ( P <0,05) .111 Очевидно, что эффект имел место, но только в подгруппе участников испытания; таким образом, эти результаты не были сочтены другими значимыми.112 Клиническое испытание, в котором сравнивали пероральный стабилизированный НАДН с психологической / диетической терапией у 31 человека с синдромом хронической усталости, показало, что один только стабилизированный НАДН снижает утомляемость в первые 4 месяца 12-месячного периода. испытание.Однако после первых 4 месяцев оценки симптомов в двух группах исследования были схожими.113 В другом исследовании стабилизированный НАДН давали перорально в течение 2 месяцев для лечения лиц с синдромом хронической усталости.114 Это лечение привело к снижению тревожности и при максимальной частоте сердечных сокращений после стресс-теста, но Alegre et al114 обнаружили мало или совсем не обнаружили различий в функциональном влиянии на утомляемость, качество жизни, качество сна, работоспособность или функциональный резерв. Таким образом, один только стабилизированный НАДН показал смешанные результаты при различных заболеваниях и расстройствах, и не все пациенты ответили на пероральные стабилизированные добавки.

Мембранные фосфолипиды

Диетическое замещение фосфолипидов митохондриальных мембран (липидозамещающая терапия [LRT]) с использованием молекул пищевого происхождения для удаления поврежденных, в основном окисленных, мембранных липидов в митохондриях и других клеточных органеллах оказалось очень эффективным для увеличения митохондриальной функции и снижение утомляемости.10,23,54,55 В некоторой степени антиоксидантные добавки могут снижать уровни ROS / RNS и предотвращать некоторое окисление фосфолипидов митохондриальной мембраны, но сами по себе антиоксиданты не могут восстановить уже нанесенный ущерб клеткам и, в частности, клеткам ». внутренние мембраны митохондрий.29,55,115

Использование фосфолипидов мембран полости рта плюс антиоксиданты в дозах от 500 до 2000 мг в день было эффективным при лечении определенных клинических состояний, таких как хроническая усталость и утомляющие заболевания. 55,67,115–117 LRT приводит к фактическая замена поврежденных мембранных фосфолипидов неповрежденными (неокисленными) липидами для обеспечения надлежащего функционирования клеточных и особенно митохондриальных мембран.

Фосфолипиды оральных мембран могут увеличивать функцию митохондрий и снижать утомляемость при синдроме хронической усталости, синдроме фибромиалгии и других утомляющих состояниях, включая естественное старение ().Например, смесь мембранных фосфолипидов и витаминов (Propax с NT-фактором) использовалась Ellithorpe et al117 в исследовании стареющих людей с тяжелой хронической усталостью, и было обнаружено, что они снижают их утомляемость на 40,5% за 8 недель. В этих исследованиях утомляемость отслеживалась с помощью шкалы Piper Fatigue Scale (PFS) для измерения клинической утомляемости и качества жизни.58 В последующем перекрестном исследовании изучалось влияние мембранных фосфолипидов на утомляемость и функцию митохондрий у пациентов с умеренной и тяжелой степенью тяжести. началась хроническая усталость.55 Пероральное введение NT-фактора в течение 12 недель привело к снижению утомляемости на 35,5% и увеличению функции митохондрий на 26,8%, тогда как после 12-недельного периода вымывания утомляемость увеличилась, а функция митохондрий снизилась до контрольных уровней. снижение наблюдалось у людей с синдромом хронической усталости и синдромом фибромиалгии, которым давали пероральные мембранные фосфолипиды (NT-фактор) .116 Использование нового состава NT-фактора плюс витамины, минералы и другие добавки у людей с умеренной хронической усталостью привело к 36.Снижение утомляемости на 8% в течение 1 недели () 118

Таблица 2

Прием пероральных мембранных фосфолипидов и усталость у хронически больных a

Участники / пациенты n Средний возраст Среднее время на LRT PFS Снижение утомляемости (%) Ссылка
Хроническая усталость 34 50,3 8 недель 40,5 c Ellithorpe et al. 20 68.9 12 недель 35,5 b Агаджанян и др. 55
Синдром хронической усталости (и / или синдром фибромиалгии) 15 44,8 8 недель 43,1 bolson Nic Ellithorpe116
Старение, усталость 67 57,3 1 нед 36,8 b Nicolson et al118
Хронические болезни 58 55.0 8 недель 30,7 b Nicolson et al 119

Комбинированная пероральная добавка для снижения утомляемости

В двухмесячном испытании лечения длительной трудноизлечимой усталости у пациентов с различными заболеваниями. диагнозов, автор и несколько коллег объединили мембранные фосфолипиды (2000 мг / сут), CoQ 10 (35 мг / сут), микрокапсулированный НАДН (35 мг / сут), l-карнитин (160 мг / сут), α-кетоглутаровую кислоту. кислота (180 мг / сут) и другие питательные вещества в пероральную добавку (топливо АТФ) для лечения усталости и митохондриальной дисфункции.119 120 58 участников этого испытания имели трудноизлечимую утомляемость от умеренной до тяжелой в течение в среднем> 17 лет и в среднем у> 15 практикующих, но без разрешения их усталость. В исследование были включены 30 человек с синдромом хронической усталости; 17 с хронической болезнью Лайма; 16 с другими изнуряющими заболеваниями, включая синдром фибромиалгии и болезнь войны в Персидском заливе; 4 с аутоиммунным заболеванием, включая ревматоидный артрит; 2 с раком; и 2 с диабетом. Эти пациенты безуспешно пробовали множество лекарств и добавок (в среднем> 35), чтобы уменьшить их усталость.

Участники этого испытания принимали комбинированную добавку LRT (ATP Fuel) в течение 8 недель, и усталость оценивалась с помощью PFS.119 PFS — это проверенный инструмент, который измеряет четыре измерения субъективной усталости: поведенческие / серьезность, аффективные / значимые, сенсорное и когнитивное / настроение.58 В исследовании использовался инструмент для расчета четырех подшкал или баллов по измерениям и общего балла утомляемости. У участников был начальный, общий, средний балл усталости от ВБП 7,51 ± 0,29, а после 8 недель приема добавок средний балл улучшился до 5.21 ± 0,28, или 30,7% снижение утомляемости ( t тест , P <0,0001; знаковый ранг Уилкоксона, P <0,0001) .119

баллов PFS можно разделить на 4 подкатегории: (1) подкатегория поведения / серьезности, которая связана с выполнением задач, общением и участием в сексуальных и других действиях, а также с интенсивностью или степенью утомляемости; (2) аффективная / значимая подкатегория, которая определяет, считает ли человек усталость / усталость приятной или неприятной, приятной или неприятной, защитной или деструктивной, нормальной или ненормальной; (3) сенсорная подкатегория, которая определяет, чувствует ли человек себя сильным или слабым, бодрствующим или сонным, бодрым или усталым, энергичным или неэнергетическим; и (4) подкатегория когнитивных способностей / настроения, которая оценивает, чувствует ли человек расслабленное или напряженное, возбужденное или подавленное, способное или неспособное сконцентрироваться, запомнить и ясно мыслить.В исследовании, обсуждаемом в этом разделе, все эти подкатегории показали значительное снижение к концу 8-недельного испытания ( P <.0001), что указывает на значительные улучшения во всех подкатегориях утомляемости. Например, произошло снижение на 30,7% ( P <0,0001) выраженности / поведения утомляемости, что указывает на значительное снижение интенсивности утомляемости и значительное повышение способности выполнять задачи, общаться, заниматься сексом и заниматься сексом. другие занятия.Кроме того, на 28,0% улучшилось настроение и когнитивные способности, такие как способность концентрироваться, запоминать и ясно мыслить.119

Регрессионный анализ данных об утомляемости

Для определения тенденций утомляемости снижение в результате использования участниками комбинированной добавки LRT (мембранные фосфолипиды, CoQ 10 , NADH, l-карнитин, α-кетоглутаровая кислота и другие ингредиенты) за время испытания, автор и его коллеги провели регрессию анализ данных, чтобы определить, были ли результаты (1) согласованными, (2) полученными с высокой степенью достоверности и (3) могли предсказать дальнейшее снижение утомляемости.119 Регрессионный анализ общей утомляемости и каждой из подкатегорий утомляемости показал значительные и последовательные тенденции к снижению данных утомляемости, предполагая, что дальнейшее снижение утомляемости было бы вероятным, если бы исследование было продолжено. Значения регрессии R 2 для различных подгрупп: (1) поведение / серьезность, 0,956; (2) аффективное значение 0,960; (3) сенсорный — 0,950; и (4) когнитивные функции / настроение — 0,980. Регрессионный анализ общей усталости дал R 2 = 0.960. Этот результат показал, что существует высокий уровень достоверности и воспроизводимости тенденций к снижению всех данных об утомляемости. Комбинированная добавка LRT была безопасна, и в ходе исследования не возникло никаких проблем с безопасностью.119 Изучение оценок, полученных от лиц с синдромом хронической усталости, болезнью Лайма или другими диагностическими категориями, не выявило серьезных различий в общей усталости или ее снижении с помощью комбинированной добавки. .119,120

Резюме

Пероральные натуральные добавки, содержащие мембранные фосфолипиды, CoQ 10 , микрокапсулированный НАДН, l-карнитин, α-липоевая кислота и другие питательные вещества, могут помочь восстановить функцию митохондрий и уменьшить стойкую усталость у пациентов с хроническими заболеваниями.Комбинация этих добавок может стать безопасным и эффективным методом снижения усталости и помочь восстановить качество жизни.

Сноски

Заявление автора о раскрытии информации

Автор не получал финансовой выгоды и не имел конфликта интересов в отношении продуктов, обсуждаемых в этой статье.

Ссылки

3. Грин Д.Р., Галлуцци Л., Кремер Г. Митохондрии и ось аутофагия-воспаление-гибель клеток при старении организма.Наука. 2011. 333 (6046): 1109–1112. [Бесплатная статья PMC] [PubMed] [Google Scholar] 4. Редди PH, Редди TP. Митохондрии как терапевтическая мишень при старении и нейродегенеративных заболеваниях. Curr Alzheimer Res. 2011. 8 (4): 393–409. [Бесплатная статья PMC] [PubMed] [Google Scholar] 5. Карбовски М., Нойцнер А. Нейродегенерация как следствие нарушения поддержания митохондрий. Acta Neuropathol. 2012. 123 (2): 157–171. [PubMed] [Google Scholar] 6. Виктор В.М., Апостолова Н., Херанс Р., Эрнандес-Миярес А., Роча М. Окислительный стресс и митохондриальная дисфункция при атеросклерозе: антиоксиданты, нацеленные на митохондрии, как потенциальная терапия.Curr Med Chem. 2009. 16 (35): 4654–4667. [PubMed] [Google Scholar] 7. Лимонгелли Дж., Масароне Д., Д’Алессандро Р., Эллиотт П.М. Митохондриальные заболевания и сердце: обзор молекулярных основ, диагностики, лечения и клинического течения. Кардиол будущего. 2012. 8 (1): 71–88. [PubMed] [Google Scholar] 8. Ма З.А., Чжао З., Тюрк Дж. Дисфункция митохондрий и недостаточность бета-клеток при сахарном диабете 2 типа. Exp Diabetes Res. 2012; 2012: 703538. DOI: 10,1155 / 2012/703538. [Бесплатная статья PMC] [PubMed] [Google Scholar] 9.Джозеф А.М., Жоанисс Д.Р., Байо Р.Г., Худ Д.А. Митохондриальная дисрегуляция в патогенезе диабета: потенциал для вмешательств, опосредованных митохондриальным биогенезом. Exp Diabetes Res. 2012; 2012: 642038. DOI: 10,1155 / 2012/642038. [Бесплатная статья PMC] [PubMed] [Google Scholar] 10. Николсон ГЛ. Метаболический синдром и функция митохондрий: молекулярная замена и антиоксидантные добавки для предотвращения перекисного окисления мембран и восстановления функции митохондрий. J Cell Biochem. 2007. 100 (6): 1352–1369. [PubMed] [Google Scholar] 11.Гафурифар П., Мусавизаде К., Парихар М.С., Назаревич Р.Р., Парихар А., Зенебе В.Дж. Митохондрии при рассеянном склерозе. Передние биоски. 2008, январь; 13: 3116–3126. [PubMed] [Google Scholar] 14. Майез К., Морхан С.Д., Чонг З.З. Биология окислительного стресса и повреждение клеток при сахарном диабете 1 и 2 типа. Curr Neurovasc Res. 2007. 4 (1): 63–71. [Бесплатная статья PMC] [PubMed] [Google Scholar] 15. Россиньоль Д.А., Фрай Р.Э. Дисфункция митохондрий при расстройствах аутистического спектра: систематический обзор и метаанализ.Мол Психиатрия. 2012. 17 (3): 290–314. [Бесплатная статья PMC] [PubMed] [Google Scholar] 16. Palmieri L, Persico AM. Митохондриальная дисфункция при расстройствах аутистического спектра: причина или следствие? Biochim Biophys Acta. 2010. 1797 (6–7): 1130–1137. [PubMed] [Google Scholar] 17. Prince JA, Harro J, Blennow K, Gottfries CG, Oreland L. Энергетический метаболизм митохондрий путамена сильно коррелирует с эмоциональными и интеллектуальными нарушениями у шизофреников. Нейропсихофармакология. 2000. 22 (3): 284–292. [PubMed] [Google Scholar] 18.Маразцити Д., Барони С., Пиккети М. и др. Психиатрические расстройства и митохондриальные дисфункции. Eur Rev Med Pharmacol Sci. 2012. 16 (2): 270–275. [PubMed] [Google Scholar] 19. Конради С., Итон М., Макдональд М.Л., Уолш Дж., Бенес Ф.М., Хекерс С. Молекулярные доказательства митохондриальной дисфункции при биполярном расстройстве. Arch Gen Psychiatry. 2004. 61 (3): 300–308. [PubMed] [Google Scholar] 20. Chitkara DK, Nurko S, Shoffner JM, Buie T., Flores A. Нарушения моторики желудочно-кишечного тракта связаны с заболеваниями окислительного фосфорилирования у детей.Am J Gastroenterol. 2003. 98 (4): 871–877. [PubMed] [Google Scholar] 21. Ди Донато С. Мультисистемные проявления митохондриальных нарушений. J Neurol. 2009. 256 (5): 693–710. [PubMed] [Google Scholar] 22. Norheim KB, Jonsson G, Omdal R. Биологические механизмы хронической усталости. Ревматология (Оксфорд) 2011; 50 (6): 1009–1018. [PubMed] [Google Scholar] 23. Николсон Г.Л., Николсон Н.Л., Бернс П., Насралла М.Ю., Хайер Дж., Насс М. Болезни войны в Персидском заливе: химические, радиологические и биологические воздействия, приводящие к хроническим утомляющим заболеваниям, можно идентифицировать и лечить.J Syndr. Хронической усталости. 2003. 11 (1): 135–154. [Google Scholar] 24. Myhill S, Booth NE, McLaren-Howard J. Синдром хронической усталости и митохондриальная дисфункция. Int J Clin Exp Med. 2009; 2 (1): 1–16. [Бесплатная статья PMC] [PubMed] [Google Scholar] 25. Кордеро MD, де Мигель М, Кармона-Лопес I, Бонал П., Кампа F, Морено-Фернандес AM. Окислительный стресс и дисфункция митохондрий при фибромиалгии. Neuro Endocrinol Lett. 2010. 31 (2): 169–173. [PubMed] [Google Scholar] 26. Рабинович Р.А., Виларо Дж. Структурные и функциональные изменения периферических мышц у пациентов с хронической обструктивной болезнью легких.Curr Opin Pulm Med. 2010. 16 (2): 123–133. [Бесплатная статья PMC] [PubMed] [Google Scholar] 27. Селекция ПК, Рассел NC, Николсон Г.Л. Интегративная модель хронически активированных иммунно-гормональных путей, важных в генерации фибромиалгии. Br J Med Pract. 2012; 5 (3): a524 – a534. [Google Scholar] 28. Сотджа Ф., Мартинес-Оутскхорн У.е., Лисанти депутат. Окислительный стресс митохондрий вызывает прогрессирование опухоли и метастазирование: следует ли использовать антиоксиданты в качестве ключевого компонента лечения и профилактики рака? BMC Med.2011; 9: 62–67. [Бесплатная статья PMC] [PubMed] [Google Scholar] 29. Николсон ГЛ. Заместительная липидная терапия: нутрицевтический подход к снижению утомляемости, связанной с раком, и побочных эффектов противоопухолевой терапии при восстановлении функции митохондрий. Раковые метастазы Ред. 2010; 29 (3): 543–552. [PubMed] [Google Scholar] 30. Габридж MG. Метаболические последствия инфекции Mycoplasma pneumoniae. Isr J Med Sci. 1987. 23 (6): 574–579. [PubMed] [Google Scholar] 31. Ашида Х., Мимуро Х., Огава М. и др. Гибель клеток и заражение: палка о двух концах для выживания хозяина и патогена.J Cell Biol. 2011; 195 (6): 931–942. [Бесплатная статья PMC] [PubMed] [Google Scholar] 32. Керр Д.С. Лечение нарушений митохондриальной цепи транспорта электронов: обзор клинических испытаний за последнее десятилетие. Mol Genet Metab. 2010. 99 (3): 246–255. [PubMed] [Google Scholar] 34. Priault M, Salin B, Schaeffer J, Vallette FM, di Rago JP, Martinou JC. Нарушение биоэнергетического статуса и биогенеза митохондрий запускает митофагию у дрожжей. Смерть клетки отличается. 2005. 12 (12): 1613–1621. [PubMed] [Google Scholar] 35.Ли Дж., Джордано С., Чжан Дж. Аутофагия, митохондрии и окислительный стресс: перекрестные помехи и редокс-сигналы. Биохим Дж. 2012; 441 (2): 523–540. [Бесплатная статья PMC] [PubMed] [Google Scholar] 36. Rich PR, Marechal A. Дыхательная цепь митохондрий. Очерки Биохимии. 2010; 47: 1–23. [PubMed] [Google Scholar] 37. Николс Д.Г. Митохондриальные ионные цепи. Очерки Биохимии. 2010; 47: 25–35. [PubMed] [Google Scholar] 38. Divakaruni AS, Бренд MD. Регуляция и физиология утечки митохондриальных протонов. Физиология (Bethesda) 2011; 26 (3): 192–205.[PubMed] [Google Scholar] 39. Рихтер С., Парк Дж. У., Эймс Б. Н.. Нормальное окислительное повреждение митохондриальной и ядерной ДНК обширно. Proc Nat Acad Sci USA. 1998. 85 (17): 6465–6467. [Бесплатная статья PMC] [PubMed] [Google Scholar] 40. Штадтман Э. Введение в серию обзоров окислительно-модифицированных белков при старении и болезнях. Free Radic Biol Med. 2002; 32 (9): 789. [Google Scholar] 41. Спектор А.А., Йорек М.А. Липидный состав мембраны и клеточная функция. J Lipid Res. 1985. 26 (9): 1015–1035. [PubMed] [Google Scholar] 42.Спителлер Г. Является ли перекисное окисление липидов полиненасыщенных кислот единственным источником свободных радикалов, вызывающих старение и возрастные заболевания? Rejuvenation Res. 2010. 13 (1): 91–103. [PubMed] [Google Scholar] 43. Дюшен М.Р., Сабадкай Г. Роль митохондрий в заболеваниях человека. Очерки Биохимии. 2010. 47: 115–137. [PubMed] [Google Scholar] 44. Chicco AJ, Sparagna GC. Роль изменений кардиолипина в митохондриальной дисфункции и болезни. Am J Physiol Cell Physiol. 2007; 292 (1): C33 – C44. [PubMed] [Google Scholar] 45.Houtkooper RH, ВАЗ FM. Кардиолипин, сердце митохондриального метаболизма. Cell Mol Life Sci. 2008. 65 (16): 2493–2506. [PubMed] [Google Scholar] 46. Барбер Д.А., Харрис С.Р. Свободные кислородные радикалы и антиоксиданты: обзор. Am Pharm. 1994; NS34 (9): 26–35. [PubMed] [Google Scholar] 47. ВС Ю. Свободные радикалы, антиоксидантные ферменты и канцерогенез. Free Radic Biol Med. 1990. 8 (6): 583–599. [PubMed] [Google Scholar] 48. Фридович И. Супероксид-радикалы и супероксиддисмутазы. Анну Рев Биохим. 1995; 64: 97–112.[PubMed] [Google Scholar] 49. Чандра Джагетия Г., Раджаникант Г.К., Рао С.К., Шринат Балига М. Изменение глутатиона, глутатионпероксидазы, супероксиддисмутазы и перекисное окисление липидов аскорбиновой кислотой в коже мышей, подвергшихся фракционированному гамма-излучению. Clin Chim Acta. 2003. 332 (1–2): 111–121. [PubMed] [Google Scholar] 50. Эшбах Р., Лолигер Дж., Скотт BC и др. Антиоксидантное действие тимола, карвакрола, 6-гингерола, зингерона и гидрокситирозола. Food Chem Toxicol. 1994. 32 (1): 31–36. [PubMed] [Google Scholar] 51.Schwartz JL. Двойная роль питательных веществ как антиоксидантов и прооксидантов: их влияние на рост опухолевых клеток. J Nutr. 1996; 126 (4) доп: 1221S – 1227S. [PubMed] [Google Scholar] 52. Прасад К.Н., Коул В.С., Кумар Б., Прасад К.С.. Научное обоснование использования высоких доз множественных микронутриентов в качестве дополнения к стандартным и экспериментальным методам лечения рака. J Am Coll Nutr. 2001; 20 (5) доп .: 450S – 453S. [PubMed] [Google Scholar] 53. Kroenke K, Wood DR, Mangelsdorff AD, Meier NJ, Powell JB. Хроническая усталость в первичной медико-санитарной помощи: распространенность, характеристики пациентов и исход.ДЖАМА. 1988. 260 (7): 929–934. [PubMed] [Google Scholar] 54. Николсон Г.Л., Сеттинери Р. Липидозаместительная терапия: функциональный подход к питанию с новыми формулами для уменьшения клеточного окислительного повреждения, связанной с раком усталости и побочных эффектов противоопухолевой терапии. Funct Foods Health Dis. 2011; 1 (4): 135–160. [Google Scholar] 55. Агаджанян М, Василевко В, Гочикян А и др. Пищевая добавка (NTFactor) восстанавливает функцию митохондрий и снижает утомляемость средней степени тяжести у пожилых людей.J Syndr. Хронической усталости. 2003. 11 (3): 23–26. [Google Scholar] 56. Бут NE, Myhill S, McLaren-Howard J. Митохондриальная дисфункция и патофизиология миалгического энцефаломиелита / синдрома хронической усталости (ME / CFS) Int J Clin Esp Med. 2012. 5 (3): 208–220. [Бесплатная статья PMC] [PubMed] [Google Scholar] 57. Моррисон JD. Усталость как жалоба в семейной практике. J Family Pract. 1980. 10 (5): 795–801. [PubMed] [Google Scholar] 58. Пайпер Б.Ф., Линси А.М., Додд М.Дж. Механизмы утомления у онкологических больных: разработка теории сестринского дела.Онкол Нурс Форум. 1987. 14 (6): 17–23. [PubMed] [Google Scholar] 59. Вэй ЙХ, Ли ХК. Окислительный стресс, мутации митохондриальной ДНК и нарушение антиоксидантных ферментов при старении. Exp Biol Med (Maywood) 2002; 227 (9): 671–682. [PubMed] [Google Scholar] 60. Хуанг Х., Manton KG. Роль окислительного повреждения митохондрий при старении: обзор. Передние биоски. 2004 Май; 9: 1100–1117. [PubMed] [Google Scholar] 61. Логан AC, Вонг С. Синдром хронической усталости: окислительный стресс и диетические модификации. Альтернативная медицина Rev.2001. 6 (5): 450–459. [PubMed] [Google Scholar] 62. Мануэль и Киной Б., Муркенс Г., Вертоммен Дж., Де Лиу И. Антиоксидантный статус и перекисное окисление липопротеинов при синдроме хронической усталости. Life Sci. 2001. 68 (17): 2037–2049. [PubMed] [Google Scholar] 63. Ричардс Р.С., Робертс Т.К., МакГрегор Н.Р., Данстан Р.Х., Батт Х.Л. Параметры крови, указывающие на окислительный стресс, связаны с выражением симптомов синдрома хронической усталости. Redox Rep. 2000; 5 (1): 35–41. [PubMed] [Google Scholar] 64. Fulle S, Mecocci P, Fano G и др.Специфические окислительные изменения в мышце широкой мышцы бедра у пациентов с диагнозом синдрома хронической усталости. Free Radic Biol Med. 2000. 29 (12): 1252–1259. [PubMed] [Google Scholar] 65. Pall ML. Повышенный и устойчивый уровень пероксинитрита как причина синдрома хронической усталости. Мед-гипотезы. 2000. 54 (1): 115–125. [PubMed] [Google Scholar] 66. Димауро С., Растин П. Критический подход к терапии митохондриальной респираторной цепи и заболеваний окислительного фосфорилирования. Biochim Biophys Acta.2009. 1792 (12): 1159–1167. [PubMed] [Google Scholar] 67. Chambers D, Bagnall AM, Hempel S, Forbes C. Вмешательства для управления лечением и реабилитации пациентов с синдромом хронической усталости / миалгическим энцепталомиелитом: обновленный систематический обзор. JR Soc Med. 2006. 99 (10): 506–520. [Бесплатная статья PMC] [PubMed] [Google Scholar] 68. Смит А.Р., Шенви С.В., Видлански М., Сух Дж. Х., Хаген TM. Липоевая кислота как потенциальная терапия хронических заболеваний, связанных с окислительным стрессом. Curr Med Chem. 2004. 11 (9): 1135–1146.[PubMed] [Google Scholar] 69. Мацзурек А., Хагер К., Кенклис М. и др. Липоевая кислота как противовоспалительное и нейрозащитное средство при болезни Альцгеймера. Adv Drug Deliv Rev. 2008; 60 (13–14): 1463–1470. [PubMed] [Google Scholar] 70. Шей К.П., Моро Р.Ф., Смит Э.Дж., Смит А.Р., Хаген TM. Альфа-липоевая кислота как пищевая добавка: молекулярные механизмы и терапевтический потенциал. Biochim Biophys Acta. 2009. 1790 (10): 1149–1160. [Бесплатная статья PMC] [PubMed] [Google Scholar] 71. Хенриксен Э.Дж., Джейкоб С., Стрипер Р.С., Фогт Д.Л., Хокама Д.Ю., Тритчлер Х.Дж.Стимуляция альфа-липоевой кислотой транспортной активности глюкозы в скелетных мышцах худых и тучных крыс Zucker. Life Sci. 1997. 61 (8): 805–812. [PubMed] [Google Scholar] 72. Гудзь Т.И., Цернг К.Ю., Хоппель К.Л. Прямое ингибирование комплекса III дыхательной цепи митохондрий проницаемым для клеток церамидом. J Biol Chem. 1997. 272 ​​(39): 24154–24158. [PubMed] [Google Scholar] 73. Ди Паола М., Кокко Т., Лоруссо М. Взаимодействие церамидов с дыхательной цепью митохондрий сердца. Биохимия. 2000. 39 (22): 6660–6668.[PubMed] [Google Scholar] 74. Монетт Дж. С., Гомес Л. А., Моро Р. Ф. и др. Обработка (R) -α-липоевой кислотой восстанавливает баланс церамидов в сердечных митохондриях стареющих крыс. Pharmacol Res. 2011; 63 (1): 23–29. [Бесплатная статья PMC] [PubMed] [Google Scholar] 75. Зиглер Д., Новак Х., Кемплер П., Варга П., Лоу ПА. Лечение симптоматической диабетической полинейропатии антиоксидантом альфа-липоевой кислотой: метаанализ. Diabet Med. 2004. 21 (2): 114–121. [PubMed] [Google Scholar] 76. Ziegler D, Low PA, Litchy WJ, et al. Эффективность и безопасность антиоксидантной терапии α-липоевой кислотой в течение 4 лет при диабетической полинейропатии: исследование NATHAN 1.Уход за диабетом. 2011. 34 (9): 2054–2060. [Бесплатная статья PMC] [PubMed] [Google Scholar] 77. Йошида К., Хирокава Дж., Тагами С., Каваками Ю., Урата Ю., Кондо Т. Ослабленная активность клеток по нейтрализации окислительного стресса при сахарном диабете: регулирование синтеза и оттока глутатиона. Диабетология. 1995. 38 (2): 201–210. [PubMed] [Google Scholar] 78. Горача А., Хук-Колега Х., Пехота А., Кленевска П., Цейка Э., Скибска Б. Липоевая кислота — биологическая активность и терапевтический потенциал. Pharmacol Rep. 2011; 63 (4): 849–858.[PubMed] [Google Scholar] 79. Глава Е, Нукала В.Н., Феноглио К.А., Муггенбург Б.А., Котман К.В., Салливан П.Г. Влияние возраста, диетического и поведенческого обогащения на митохондрии мозга на собачьей модели старения человека. Exp Neurol. 2009. 220 (1): 171–176. [Бесплатная статья PMC] [PubMed] [Google Scholar] 80. Марковина С.М., Сиртори С., Перачино А. и др. Перевод базовых знаний о митохондриальных функциях в метаболическую терапию: роль L-карнитина. Перевод Рез. 2013. 161 (2): 73–84. [Бесплатная статья PMC] [PubMed] [Google Scholar] 81.Reuter SE, Evans AM. Карнитин и ацилкарнитины: фармакокинетические, фармакологические и клинические аспекты. Клин Фармакокинет. 2012. 51 (9): 553–572. [PubMed] [Google Scholar] 82. Newgard CB, An J, Bain JR и др. Метаболическая характеристика, связанная с аминокислотами с разветвленной цепью, которая отличает людей с ожирением от худощавых и способствует развитию инсулинорезистентности. Cell Metab. 2009. 9 (4): 311–326. [Бесплатная статья PMC] [PubMed] [Google Scholar] 83. Ковес Т.Р., Ашер Дж.Р., Ноланд Р.К. и др. Перегрузка митохондрий и неполное окисление жирных кислот способствуют развитию инсулинорезистентности скелетных мышц.Cell Metab. 2008. 7 (1): 45–56. [PubMed] [Google Scholar] 84. Shah SH, Hauser ER, Bain JR, et al. Высокая наследуемость метаболомных профилей в семьях с преждевременным сердечно-сосудистым заболеванием. Mol Syst Biol. 2009; 5: 258. DOI: 10.1038 / msb.2009.11. [Бесплатная статья PMC] [PubMed] [Google Scholar] 85. Сприт Л.Л., Перри К.Г., Таланян Дж.Л. Допустимые пищевые добавки перед соревнованиями для улучшения энергетического обмена. Очерки Биохимии. 2008; 44: 27–43. [PubMed] [Google Scholar] 86. Латунь EP. Дополнительный карнитин и упражнения.Am J Clin Nutr. 2000; 72 (2) доп .: 618S – 623S. [PubMed] [Google Scholar] 87. Вахтер С., Фогт М., Крейс Р. и др. Длительное введение L-карнитина людям: влияние на содержание карнитина в скелетных мышцах и физическую работоспособность. Clin Chim Acta. 2002. 318 (1-2): 51–61. [PubMed] [Google Scholar] 88. Ананд I, Чандрашехан Й., Де Джули Ф. и др. Острые и хронические эффекты пропионил-L-карнитина на гемодинамику, работоспособность и гормоны у пациентов с застойной сердечной недостаточностью. Кардиоваск наркотики Ther.1998. 12 (3): 291–299. [PubMed] [Google Scholar] 89. Hagen TM, Moreau R, Suh JH, Visioli F. Митохондриальный распад в стареющем сердце крысы: доказательства улучшения за счет пищевых добавок с ацетил-L-карнитином и / или липоевой кислотой. Ann NY Acad Sci. 2002 апр; 959: 491–507. [PubMed] [Google Scholar] 91. Malaguarnera M, Cammalleri L, Gargante MP, Vacante M, Colonna V, Motta M. Лечение L-карнитином снижает степень физической и умственной усталости и увеличивает когнитивные функции у долгожителей: рандомизированное и контролируемое клиническое исследование.Am J Clin Nutr. 2007. 86 (6): 1738–1744. [PubMed] [Google Scholar] 92. Литтарру Г.П., Тиано Л. Клинические аспекты коэнзима Q10: обновленная информация. Питание. 2010. 26 (3): 250–254. [PubMed] [Google Scholar] 93. Гронеберг Д.А., Киндерманн Б., Альтхаммер М. и др. Коэнзим Q10 влияет на экспрессию генов, участвующих в передаче сигналов, метаболизме и транспорте в клетках CaCo-2. Int J Biochem Cell Biol. 2005. 37 (6): 1208–1218. [PubMed] [Google Scholar] 94. Orsucci D, Mancuso M, Ienco EC, LoGerfo A, Siciliano G. Нацеливание на митохондриальную дисфункцию и нейродегенерацию с помощью коэнзима Q10 и его аналогов.Curr Med Chem. 2011. 18 (26): 4053–4064. [PubMed] [Google Scholar] 95. Розенфельдт Ф., Хилтон Д., Пепе С., Крам Х. Систематический обзор эффекта коэнзима Q10 при физических упражнениях, гипертонии и сердечной недостаточности. Биофакторы. 2003. 18 (1–4): 91–100. [PubMed] [Google Scholar] 96. Мизуно К., Танака М., Нозаки С. и др. Эффекты утомляемости коэнзима Q10 при физической усталости. Питание. 2008. 24 (4): 293–299. [PubMed] [Google Scholar] 97. Ли Джи, Джек CR, Ян XF, Ян ES. Пищевая добавка CoQ10 задерживает атрофию мозга у старых трансгенных мышей с мутациями в белке-предшественнике амилоида: исследование in vivo на объемной МРТ .Биофакторы. 2008. 32 (1–4): 169–178. [PubMed] [Google Scholar] 98. Ян X, Дай Г, Ли Г, Ян ES. Коэнзим Q10 снижает бета-амилоидные бляшки в модели болезни Альцгеймера у трансгенных мышей APP / PS1. J Mol Neurosci. 2010. 41 (1): 110–113. [PubMed] [Google Scholar] 99. Галаско Д.Р., Пескинд Э., Кларк С.М. и др. Совместное исследование болезни Альцгеймера. Антиоксиданты при болезни Альцгеймера: рандомизированное клиническое испытание с измерением биомаркеров спинномозговой жидкости. Arch Neurol. 2012. 69 (7): 836–841. [Бесплатная статья PMC] [PubMed] [Google Scholar] 100.Isobe C, Abe T, Terayama Y. Уровни восстановленного и окисленного кофермента Q10 и 8-гидрокси-2′-дезоксигуанозина в спинномозговой жидкости у пациентов с болезнью Паркинсона при жизни демонстрируют, что окислительное повреждение митохондрий и / или окислительное повреждение ДНК способствует нейродегенеративному процессу. процесс. Neurosci Lett. 2010. 469 (1): 159–163. [PubMed] [Google Scholar] 101. Группа изучения Хантингтона. Рандомизированное плацебо-контролируемое исследование коэнзима Q10 и ремасемида при болезни Хантингтона. Неврология. 2001. 57 (3): 397–404.[PubMed] [Google Scholar] 102. Кауфманн П., Томпсон Дж. Л., Леви Г. и др. Исследовательская группа QALS. Испытание фазы II CoQ10 для лечения БАС не нашло достаточных доказательств для обоснования фазы III. Энн Нейрол. 2009. 66 (2): 235–244. [Бесплатная статья PMC] [PubMed] [Google Scholar] 103. Мэтьюз П.М., Форд Б., Дандуранд Р.Дж. и др. Коэнзим Q10 с множеством витаминов обычно неэффективен при лечении митохондриальных заболеваний. Неврология. 1993. 43 (5): 884–890. [PubMed] [Google Scholar] 104. Penberthy WT. Никотинамид-аденин-динуклеотид — биология и болезнь.Curr Pharm Des. 2009; 15 (1): 1-2. [PubMed] [Google Scholar] 105. Киркланд JB. Статус ниацина, распределение НАД и метаболизм АДФ-рибозы. Curr Pharm Des. 2009. 15 (1): 3–11. [PubMed] [Google Scholar] 106. Birkmayer JG. Коэнзим никотинамида адениндинуклеотид: новый терапевтический подход для улучшения деменции типа Альцгеймера. Ann Clin Lab Sci. 1996; 26 (1): 1–9. [PubMed] [Google Scholar] 107. Райнер М, Краксбергер Э, Хаусхофер М, Маке Х.А., Джеллингер К.А. Нет доказательств улучшения когнитивных функций от перорального приема никотинамидадениндинуклеотида (НАДН) при деменции.J Neural Transm. 2000. 107 (12): 1475–1481. [PubMed] [Google Scholar] 108. Демарин В., Подобник С.С., Сторга-Томич Д., Кей Г. Лечение болезни Альцгеймера стабилизированным пероральным никотинамид-адениндинуклеотидом: рандомизированное двойное слепое исследование. Препараты Exp Clin Res. 2004. 30 (1): 27–33. [PubMed] [Google Scholar] 109. Birkmayer JG, Vrecko C, Volc D, Birkmayer W. Никотинамид адениндинуклеотид (NADH) — новый терапевтический подход к болезни Паркинсона: сравнение перорального и парентерального применения. Acta Neurol Scand Suppl.1993. 146: 32–35. [PubMed] [Google Scholar] 110. Диздар Н., Кагедал Б., Линдвалл Б. Лечение болезни Паркинсона с помощью НАДН. Acta Neurol Scand. 1994. 90 (5): 345–347. [PubMed] [Google Scholar] 111. Форсайт Л. М., Пройс Г. Г., МакДауэлл А. Л., Кьяцце Л. Младший, Биркмайер Г. Д., Белланти Д. А.. Терапевтические эффекты перорального НАДН на симптомы у пациентов с синдромом хронической усталости. Ann Allergy Asthma Immunol. 1999. 82 (2): 185–191. [PubMed] [Google Scholar] 112. Colquhoun D, ​​Senn S. Эффективен ли НАДН при лечении синдрома хронической усталости? Ann Allergy Asthma Immunol.2000. 84 (6): 639–640. [PubMed] [Google Scholar] 113. Santaella ML, шрифт I, Disdier OM. Сравнение перорального приема никотинамидадениндинуклеотида (НАДН) с традиционной терапией синдрома хронической усталости. P R Health Sci J. 2004; 23 (2): 89–93. [PubMed] [Google Scholar] 114. Алегре Дж., Розес Дж. М., Хавьер С., Руис-Бакес А., Сегундо М. Дж., Де Севилья Т. Ф. Никотинамидадениндинуклеотид (НАДН) у пациентов с синдромом хронической усталости [на испанском языке] Rev Clin Esp. 2010. 210 (6): 284–288. [PubMed] [Google Scholar] 115.Николсон ГЛ. Замещение липидов в качестве дополнения к терапии хронической усталости, против старения и восстановления митохондриальной функции. J Am Nutraceutical Assoc. 2003. 6 (3): 22–28. [Google Scholar] 116. Николсон Г.Л., Эллиторп Р. Замещение липидов и антиоксидантная нутритивная терапия для восстановления функции митохондрий и снижения утомляемости при синдроме хронической усталости и других утомляющих заболеваниях. J Syndr. Хронической усталости. 2006. 13 (1): 57–68. [Google Scholar] 117. Эллиторп Р.Р., Сеттинери Р.А., Николсон Г.Л. Экспериментальное исследование: снижение утомляемости за счет применения пищевой добавки, содержащей гликофосфолипиды.J Am Nutraceutical Assoc. 2003. 6 (1): 23–28. [Google Scholar] 118. Nicolson GL, Ellithorpe RR, Ayson-Mitchell C, Jacques B, Settineri R. Заместительная липидная терапия с применением гликофосфолипид-антиоксидантно-витаминной композиции значительно снижает утомляемость в течение одной недели. J Am Nutraceutical Assoc. 2010. 13 (1): 10–14. [Google Scholar] 119. Николсон Г.Л., Сеттинери Р., Эллиторп Р. Заместительная липидная терапия с использованием гликофосфолипидного состава с НАДН и CoQ10 значительно снижает утомляемость у трудноизлечимых хронических утомительных заболеваний и пациентов с хронической болезнью Лайма.Int J Clin Med. 2012. 3 (3): 163–170. [Google Scholar] 120. Nicolson GL, Settineri R, Ellithorpe R. Состав гликофосфолипида с NADH и CoQ10 значительно снижает трудноизлечимое утомление у пациентов с хронической болезнью Лайма, положительных по Вестерн-блоттингу: предварительный отчет. Funct Foods Health Dis. 2012. 2 (3): 35–47. [Google Scholar]

Дисфункция митохондрий при неврологических расстройствах: Изучение трансплантации митохондрий

  • 1.

    Фрей Т. и Маннелла К. А. Внутренняя структура митохондрий. Trends Biochem. Sci. 25 , 319–324 (2000).

    CAS
    PubMed

    Google ученый

  • 2.

    Пикард, М., Тайвассало, Т., Гуспиллу, Г. и Хеппл, Р. Т. Митохондрии: изоляция, структура и функция. J. Physiol. 589 , 4413–4421 (2011).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 3.

    Роуз, Дж.и другие. Дисфункция митохондрий в глиальных клетках: последствия для гомеостаза и выживания нейронов. Токсикология 391 , 109–115 (2017).

    CAS
    PubMed

    Google ученый

  • 4.

    Лю, Ф., Лу, Дж., Манаенко, А., Тан, Дж. И Ху, К. Митохондрии при ишемическом инсульте: новое понимание и последствия. Aging Dis. 9 , 924–937 (2018).

    PubMed
    PubMed Central

    Google ученый

  • 5.

    Briston, T. et al. Митохондриальная проницаемость переходной поры: чувствительность к открытию и механистическая зависимость от доступности субстрата. Sci. Отчетность 7 , 10492 (2017).

    PubMed
    PubMed Central

    Google ученый

  • 6.

    Халестрап, А. П. и Ричардсон, А. П. Переход митохондриальной проницаемости: современные взгляды на его особенности и роль в ишемии / реперфузионном повреждении. Дж.Мол. Клетка. Кардиол. 78 , 129–141 (2015).

    CAS
    PubMed

    Google ученый

  • 7.

    Mylonas, C. & Kouretas, D. Перекисное окисление липидов и повреждение тканей. In vivo 13 , 295–309 (1999).

    CAS
    PubMed

    Google ученый

  • 8.

    де Васконселос, Н. М., Ван Опденбош, Н., Ван Горп, Х., Партоенс, Э. и Ламканфи, М.Одноклеточный анализ динамики пироптоза выявляет консервативные GSDMD-опосредованные субклеточные события, которые предшествуют разрыву плазматической мембраны. Cell Death Differ. 26 , 146–161 (2019).

    PubMed

    Google ученый

  • 9.

    Dixon, S.J. et al. Ферроптоз: железозависимая форма неапоптотической гибели клеток. Cell 149 , 1060–1072 (2012).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 10.

    Фатокун, А. А., Доусон, В. Л. и Доусон, Т. М. Партанатос: митохондриально-связанные механизмы и терапевтические возможности. Br. J. Pharm. 171 , 2000–2016 (2014).

    CAS

    Google ученый

  • 11.

    Gao, M. et al. Роль митохондрий в ферроптозе. Мол. Ячейка 73 , 354–363 e353 (2019).

    CAS
    PubMed

    Google ученый

  • 12.

    Маршалл, К. Д. и Бейнс, К. П. Некроптоз: роль митохондрий? Фронт. Physiol. 5 , 323 (2014).

    PubMed
    PubMed Central

    Google ученый

  • 13.

    DeGregorio-Rocasolano, N., Marti-Sistac, O. & Gasull, T. Расшифровка железной стороны инсульта: нейродегенерация на перекрестке железного дисгомеостаза, эксайтотоксичности и ферроптоза. Фронт. Neurosci. 13 , 85 (2019).

    PubMed
    PubMed Central

    Google ученый

  • 14.

    До Ван Б. и др. Ферроптоз, недавно охарактеризованная форма гибели клеток при болезни Паркинсона, которая регулируется PKC. Neurobiol. Дис. 94 , 169–178 (2016).

    PubMed

    Google ученый

  • 15.

    Лейн, Д. Дж. Р., Эйтон, С. и Буш, А. И. Железо и болезнь Альцгеймера: обновленная информация о новых механизмах. J. Alzheimers Dis. 64 , S379 – S395 (2018).

    CAS
    PubMed

    Google ученый

  • 16.

    Xie, B. S. et al. Ингибирование ферроптоза уменьшает повреждение тканей и улучшает отдаленные результаты после черепно-мозговой травмы у мышей. CNS Neurosci. Ther. 25 , 465–475 (2019).

    CAS
    PubMed

    Google ученый

  • 17.

    Lai, Y. et al. STYK1 / NOK коррелирует с ферроптозом при немелкоклеточной карциноме легкого. Biochem. Биофиз. Res. Commun. 519 , 659–666 (2019).

    CAS
    PubMed

    Google ученый

  • 18.

    ДеХарт, Д. Н. и др. Открытие потенциалзависимых анионных каналов способствует образованию активных форм кислорода, митохондриальной дисфункции и гибели раковых клеток. Biochem. Pharm. 148 , 155–162 (2018).

    CAS
    PubMed

    Google ученый

  • 19.

    Krainz, T. et al. Нитроксид, нацеленный на митохондрии, является мощным ингибитором ферроптоза. САУ Cent. Sci. 2 , 653–659 (2016).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 20.

    Yang, W. S. et al. Регулирование гибели ферроптотических раковых клеток с помощью GPX4. Ячейка 156 , 317–331 (2014).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 21.

    Azevedo, R. S. S. et al. Иммунный ответ in situ и механизмы повреждения клеток центральной нервной системы при летальной микроцефалии вирусом Зика. Sci. Отчет 8 , 1 (2018).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 22.

    Slee, E. A., Adrain, C. & Martin, S.J. Executioner каспаза-3, -6 и -7 выполняют отдельные, неизбыточные роли во время фазы разрушения апоптоза. J. Biol. Chem. 276 , 7320–7326 (2001).

    CAS
    PubMed

    Google ученый

  • 23.

    ван дер Блик, А. М., Шен, К. и Каваджири, С. Механизмы деления и слияния митохондрий. Cold Spring Harb. Перспектива. Биол. 5 , a011072 (2013).

    PubMed
    PubMed Central

    Google ученый

  • 24.

    Мейер, Дж. Н., Лейтнер, Т. К. и Луз, А. Л. Митохондриальное слияние, деление и митохондриальная токсичность. Токсикология 391 , 42–53 (2017).

    CAS
    PubMed

    Google ученый

  • 25.

    Querfurth, H. W. & LaFerla, F. M. Болезнь Альцгеймера. N. Engl. J. Med. 362 , 329–344 (2010).

    CAS
    PubMed

    Google ученый

  • 26.

    Patergnani, S. et al. Митохондрии при рассеянном склерозе: молекулярные механизмы патогенеза. Внутр. Rev. Cell Mol. Биол. 328 , 49–103 (2017).

    CAS
    PubMed

    Google ученый

  • 27.

    Свердлоу Р. Х. и Хан С. М. Гипотеза митохондриального каскада болезни Альцгеймера: обновление. Exp. Neurol. 218 , 308–315 (2009).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 28.

    Du, H. et al. Дефицит циклофилина D ослабляет митохондриальные и нейрональные нарушения и улучшает обучение и память при болезни Альцгеймера. Нат. Med. 14 , 1097–1105 (2008).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 29.

    Рао, В. К., Карлсон, Э. А. и Ян, С. С. Переходная пора проницаемости митохондрий является потенциальной лекарственной мишенью для нейродегенерации. Biochim.Биофиз. Acta 1842 , 1267–1272 (2014).

    CAS
    PubMed

    Google ученый

  • 30.

    Ду, Х. и ШиДу Ян, С. Открывая дверь к нейрональным проблемам при болезни Альцгеймера: абета и переходная пора проницаемости митохондрий. Фармацевтические препараты 3 , 1936–1948 (2010).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 31.

    Тайснес, О. Б. и Сторстейн, А. Эпидемиология болезни Паркинсона. J. Neural Transm. 124 , 901–905 (2017).

    PubMed

    Google ученый

  • 32.

    Winkler-Stuck, K. et al. Повторная оценка дисфункции митохондриальной дыхательной цепи в скелетных мышцах пациентов с болезнью Паркинсона. J. Neural Transm. 112 , 499–518 (2005).

    CAS
    PubMed

    Google ученый

  • 33.

    Гу, М., Купер, Дж. М., Таанман, Дж. В. и Шапира, А. Х. Передача митохондриальной ДНК митохондриального дефекта при болезни Паркинсона. Ann. Neurol. 44 , 177–186 (1998).

    CAS
    PubMed

    Google ученый

  • 34.

    Ekstrand, M. I. et al. Прогрессирующий паркинсонизм у мышей с дофаминовыми нейронами с дефицитом дыхательной цепи. Proc. Natl Acad. Sci. США 104 , 1325–1330 (2007).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 35.

    Кляйн К. и Вестенбергер А. Генетика болезни Паркинсона. Cold Spring Harb. Перспектива. Med. 2 , a008888 (2012).

    PubMed
    PubMed Central

    Google ученый

  • 36.

    Lucking, C. B. et al. Связь между ранним началом болезни Паркинсона и мутациями в гене паркина. N. Engl. J. Med. 342 , 1560–1567 (2000).

    CAS
    PubMed

    Google ученый

  • 37.

    Gandhi, S. et al. Белок PINK1 в нормальном мозге человека и болезнь Паркинсона. Мозг 129 , 1720–1731 (2006).

    CAS
    PubMed

    Google ученый

  • 38.

    Wood-Kaczmar, A. et al. PINK1 необходим для длительного выживания и функции митохондрий дофаминергических нейронов человека. PLoS ONE 3 , e2455 (2008 г.).

    PubMed
    PubMed Central

    Google ученый

  • 39.

    Mallach, A. et al. Патологоанатомическое исследование мозга при болезни Паркинсона предполагает снижение митохондриальной биомассы, которое устраняется глубокой стимуляцией подталамического ядра мозга. FASEB J. 33 , 6957–6961 (2019).

    CAS
    PubMed

    Google ученый

  • 40.

    Кинтанилья Р. А. и Джонсон Г. В. Роль митохондриальной дисфункции в патогенезе болезни Хантингтона. Brain Res. Бык. 80 , 242–247 (2009).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 41.

    Lin, J. et al. Дефекты адаптивного энергетического метаболизма с гиперактивностью, связанной с ЦНС, у мышей без PGC-1alpha. Cell 119 , 121–135 (2004).

    CAS
    PubMed

    Google ученый

  • 42.

    Milakovic, T. & Johnson, G. V. Митохондриальное дыхание и продукция АТФ значительно нарушены в полосатых клетках, экспрессирующих мутантный хантингтин. J. Biol. Chem. 280 , 30773–30782 (2005).

    CAS
    PubMed

    Google ученый

  • 43.

    Чу, Ю. С., Джонсон, Г. В., Макдональд, М., Детлофф, П. Дж. И Лесорт, М. Мутантный хантингтин напрямую увеличивает восприимчивость митохондрий к индуцированному кальцием переходу проницаемости и высвобождению цитохрома с. Hum. Мол. Genet. 13 , 1407–1420 (2004).

    CAS
    PubMed

    Google ученый

  • 44.

    Теллез-Нагель, И., Джонсон, А. Б. и Терри, Р. Д. Исследования биопсии головного мозга пациентов с хореей Хантингтона. J. Neuropathol. Exp. Neurol. 33 , 308–332 (1974).

    CAS
    PubMed

    Google ученый

  • 45.

    Сонг, В.и другие. Мутантный хантингтин связывает митохондриальный белок-1, связанный с динамином ГТФазой деления, и увеличивает его ферментативную активность. Нат. Med. 17 , 377–382 (2011).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 46.

    Weydt, P. et al. Нарушения терморегуляции и метаболизма у трансгенных мышей с болезнью Гентингтона причастны PGC-1alpha к нейродегенерации при болезни Гентингтона. Cell Metab. 4 , 349–362 (2006).

    CAS
    PubMed

    Google ученый

  • 47.

    Writing Group, M. et al. Обновление статистики сердечных заболеваний и инсульта за 2016 г .: отчет Американской кардиологической ассоциации. Тираж 133 , e38 – e360 (2016).

    Google ученый

  • 48.

    Хофмейер, Дж. И ван Путтен, М. Дж. Ишемическое повреждение головного мозга: оценка синаптической недостаточности. Инсульт 43 , 607–615 (2012).

    PubMed

    Google ученый

  • 49.

    Дхармасароджа, П. А. Потребление жидкости, связанное с отеком мозга при остром инфаркте средней мозговой артерии. Пер. Stroke Res. 7 , 49–53 (2016).

    PubMed

    Google ученый

  • 50.

    Saita, S. et al. Различные типы протеазных систем участвуют в регуляции гомеостаза морфологии митохондрий посредством сбалансированного слияния и деления. Гены Клеток 21 , 408–424 (2016).

    CAS
    PubMed

    Google ученый

  • 51.

    Симс, Н. Р. и Муйдерман, Х. Митохондрии, окислительный метаболизм и гибель клеток при инсульте. Biochim. Биофиз. Acta 1802 , 80–91 (2010).

    CAS
    PubMed

    Google ученый

  • 52.

    Bereiter-Hahn, J. & Voth, M. Динамика митохондрий в живых клетках: изменения формы, дислокации, слияние и деление митохондрий. Microsc. Res. Tech. 27 , 198–219 (1994).

    CAS
    PubMed

    Google ученый

  • 53.

    Wang, J. et al. Mdivi-1 предотвращает апоптоз, вызванный ишемией-реперфузионным повреждением в первичных клетках гиппокампа, посредством ингибирования митохондриального пути, активируемого активными формами кислорода. J. Stroke Cerebrovasc. Дис. 23 , 1491–1499 (2014).

    PubMed

    Google ученый

  • 54.

    Cowan, D. B. et al. Интракоронарная доставка митохондрий к ишемическому сердцу для кардиопротекции. PLoS ONE 11 , e0160889 (2016).

    PubMed
    PubMed Central

    Google ученый

  • 55.

    McCully, J. D. et al. Инъекция изолированных митохондрий во время ранней реперфузии для кардиопротекции. Am. J. Physiol. Heart Circ. Physiol. 296 , H94 – h205 (2009 г.).

    CAS
    PubMed

    Google ученый

  • 56.

    Маккалли, Дж. Д., Левицкий, С., Дель Нидо, П. Дж. И Коуэн, Д. Б. Трансплантация митохондрий для терапевтического использования. Clin. Пер. Med. 5 , 16 (2016).

    PubMed
    PubMed Central

    Google ученый

  • 57.

    Masuzawa, A. et al. Трансплантация митохондрий собственного происхождения защищает сердце от ишемического реперфузионного повреждения. Am. J. Physiol. Heart Circ. Physiol. 304 , H966 – H982 (2013 г.).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 58.

    Эмани, С. М., Пекарски, Б. Л., Харрилд, Д., Дель Нидо, П. Дж. И МакКалли, Дж. Д. Аутологичная трансплантация митохондрий при дисфункции после ишемии-реперфузионного повреждения. J. Thorac. Кардиоваск. Surg. 154 , 286–289 (2017).

    PubMed

    Google ученый

  • 59.

    Эмани, С.М. и Маккалли, Дж. Д. Трансплантация митохондрий: приложения для педиатрических пациентов с врожденными пороками сердца. Пер. Педиатр. 7 , 169–175 (2018).

    PubMed
    PubMed Central

    Google ученый

  • 60.

    Zhang, Z. et al. Мышечная аутологичная трансплантация митохондрий: новая стратегия лечения ишемического повреждения головного мозга. Behav. Brain Res. 356 , 322–331 (2019).

    CAS
    PubMed

    Google ученый

  • 61.

    Liu, K. et al. Мезенхимальные стволовые клетки спасают поврежденные эндотелиальные клетки в модели ишемии-реперфузии in vitro посредством туннельного переноса митохондрий, опосредованного структурой нанотрубок. Microvasc. Res. 92 , 10–18 (2014).

    CAS
    PubMed

    Google ученый

  • 62.

    Пан Б. Т. и Джонстон Р.М. Судьба рецептора трансферрина во время созревания ретикулоцитов овцы in vitro: селективная экстернализация рецептора. Cell 33 , 967–978 (1983).

    CAS
    PubMed

    Google ученый

  • 63.

    Kramer-Albers, E.M. et al. Олигодендроциты секретируют экзосомы, содержащие основной миелин и защитные белки от стресса: трофическая поддержка аксонов? Proteom. Clin. Заявление 1 , 1446–1461 (2007).

    Google ученый

  • 64.

    Симпсон, Р. Дж., Дженсен, С. С. и Лим, Дж. У. Протеомное профилирование экзосом: современные перспективы. Proteomics 8 , 4083–4099 (2008).

    CAS
    PubMed

    Google ученый

  • 65.

    Puhm, F. et al. Митохондрии представляют собой подмножество внеклеточных везикул, высвобождаемых активированными моноцитами, и индуцируют ответы IFN и TNF типа I в эндотелиальных клетках. Circ. Res. 125 , 43–52 (2019).

    CAS
    PubMed

    Google ученый

  • 66.

    Hayakawa, K. et al. Перенос митохондрий от астроцитов к нейронам после инсульта. Nature 535 , 551–555 (2016).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 67.

    Рустом, А., Саффрич, Р., Маркович, И., Вальтер, П.И Гердес, Х. Х. Нанотубулярные магистрали для межклеточного транспорта органелл. Наука 303 , 1007–1010 (2004).

    CAS
    PubMed

    Google ученый

  • 68.

    Hayakawa, K. et al. Защитные эффекты внеклеточных митохондрий эндотелиальных клеток-предшественников в эндотелии головного мозга. Стволовые клетки 36 , 1404–1410 (2018).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 69.

    Kaneko, Y. et al. Клеточная терапия при инсульте: акцент на оптимизации профиля безопасности и эффективности эндотелиальных клеток-предшественников. Curr. Pharm. Des. 18 , 3731–3734 (2012).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 70.

    Preble, J. M. et al. Быстрое выделение и очистка митохондрий для трансплантации путем диссоциации тканей и дифференциальной фильтрации. J. Vis. Эксп 91 , e51682 (2014).

    Google ученый

  • 71.

    Poot, M. et al. Анализ морфологии и функции митохондрий с помощью новых фиксируемых флуоресцентных красителей. J. Histochem. Cytochem. 44 , 1363–1372 (1996).

    CAS
    PubMed

    Google ученый

  • 72.

    Shi, X., Zhao, M., Fu, C. & Fu, A. Внутривенное введение митохондрий для лечения экспериментальной болезни Паркинсона. Митохондрия 34 , 91–100 (2017).

    CAS
    PubMed

    Google ученый

  • 73.

    Sun, C. et al. Трансплантация митохондрий, опосредованная эндоцитозом: перенос нормальных митохондрий астроцитов человека в клетки глиомы восстанавливает аэробное дыхание и повышает радиочувствительность. Theranostics 9 , 3595–3607 (2019).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 74.

    Lippert, T. & Borlongan, C. V. Профилактическое лечение гипербарическим кислородом снижает воспалительную реакцию через перенос митохондрий. CNS Neurosci. Ther. 25 , 815–823 (2019).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 75.

    Joshi, A.U. et al. Фрагментированные митохондрии, высвобождаемые из микроглии, вызывают астроцитарный ответ A1 и способствуют воспалительной нейродегенерации. Нат. Neurosci. 22 , 1635–1648 (2019).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 76.

    Robicsek, O. et al. Изолированный перенос митохондрий улучшает нейрональную дифференцировку плюрипотентных стволовых клеток, вызванных шизофренией, и устраняет дефицит в модели заболевания на крысах. Schizophr. Бык. 44 , 432–442 (2018).

    PubMed

    Google ученый

  • 77.

    Yao, Y. et al. Коннексин 43-опосредованный митохондриальный перенос ИПСК-МСК облегчает воспаление при астме. Stem Cell Rep. 11 , 1120–1135 (2018).

    CAS

    Google ученый

  • 78.

    Partikian, A., Olveczky, B., Swaminathan, R., Li, Y. & Verkman, A. S. Быстрая диффузия зеленого флуоресцентного белка в матриксе митохондрий. J. Cell Biol. 140 , 821–829 (1998).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 79.

    Gao, L., Zhang, Z., Lu, J. & Pei, G. Митохондрии динамически передаются между нервными клетками человека, и мутации GFAP, связанные с болезнью Александра, нарушают перенос астроцитов. Фронт. Клетка. Neurosci. 13 , 316 (2019).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 80.

    Gollihue, J. L. et al. Влияние трансплантации митохондрий на биоэнергетику, включение клеток и функциональное восстановление после травмы спинного мозга. J. Neurotrauma 35 , 1800–1818 (2018).

    PubMed
    PubMed Central

    Google ученый

  • 81.

    Kitani, T. et al. Прямой перенос митохондрий человека: новая концепция, основанная на теории эндосимбиотиков. Transpl. Proc. 46 , 1233–1236 (2014).

    CAS

    Google ученый

  • 82.

    Rocca, C.J. et al. Трансплантация гемопоэтических стволовых и клеток-предшественников мыши дикого типа уменьшает дефицит на мышиной модели атаксии Фридрейха. Sci. Пер. Med. 9 , eaaj2347 (2017).

    PubMed
    PubMed Central

    Google ученый

  • 83.

    Laker, R.C. et al. Новый репортерный ген MitoTimer для определения содержания, структуры, стресса и повреждений митохондрий in vivo. J. Biol. Chem. 289 , 12005–12015 (2014).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 84.

    Wilson, R.J. et al. Условные мыши-репортеры MitoTimer для оценки структуры митохондрий, окислительного стресса и митофагии. Митохондрия 44 , 20–26 (2019).

    CAS
    PubMed

    Google ученый

  • 85.

    Голлихью Дж. Л. и Рабчевский А. Г. Перспективы терапевтической трансплантации митохондрий. Митохондрия 35 , 70–79 (2017).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 86.

    Islam, M. N. et al. Перенос митохондрий от стромальных клеток костного мозга к легочным альвеолам защищает от острого повреждения легких. Нат. Med. 18 , 759–765 (2012).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 87.

    Спес, Дж. Л., Олсон, С. Д., Уитни, М. Дж. И Прокоп, Д. Дж. Перенос митохондрий между клетками может спасти аэробное дыхание. Proc. Natl Acad. Sci.США 103 , 1283–1288 (2006).

    CAS
    PubMed
    PubMed Central

    Google ученый

  • 88.

    Паливал, С., Чаудхури, Р., Агравал, А. и Моханти, С. Регенеративные способности мезенхимальных стволовых клеток посредством митохондриального переноса. J. Biomed. Sci. 25 , 31 (2018).

    PubMed
    PubMed Central

    Google ученый

  • 89.

    Huang, P.J. et al. Перенос ксеногенных митохондрий обеспечивает нервную защиту от ишемического стресса в ишемизированном мозге крыс. Cell Transpl. 25 , 913–927 (2016).

    CAS

    Google ученый

  • 90.

    Hayakawa, K. et al. Внеклеточные митохондрии для терапии и диагностики острого повреждения центральной нервной системы. JAMA Neurol. 75 , 119–122 (2018).

    PubMed
    PubMed Central

    Google ученый

  • 91.

    Плетюшкина О.Ю. и др. Влияние окислительного стресса на динамику митохондриального ретикулума. Biochim. Биофиз. Acta 1757 , 518–524 (2006).

    CAS
    PubMed

    Google ученый

  • 92.

    Chandel, N. S. Эволюция митохондрий как сигнальных органелл. Cell Metab. 22 , 204–206 (2015).

    CAS
    PubMed

    Google ученый

  • 93.

    Нисоли, Э., Клементи, Э., Монкада, С. и Карруба, М. О. Митохондриальный биогенез как клеточная сигнальная структура. Biochem. Pharm. 67 , 1–15 (2004).

    CAS
    PubMed

    Google ученый

  • 94.

    Шолкманн, Ф. Физическая передача сигналов от клетки к клетке на большие расстояния через митохондрии внутри мембранных нанотрубок: гипотеза. Теор. Биол. Med. Модель. 13 , 16 (2016).

    PubMed
    PubMed Central

    Google ученый

  • Митохондриальная дисфункция: симптомы и лечение

    Одна из самых интересных областей исследований расстройств аутистического спектра (РАС) — это роль митохондриальной функции .Научные исследования, изучающие функцию митохондрий у людей с аутизмом, меняют наши представления о причинах аутизма и указывают на медицинские методы лечения, которые могут оказать существенное влияние. В этой статье речь пойдет о роли митохондрий в аутизме, а также о диагностике и лечении митохондриальной дисфункции.

    Что такое митохондрии?

    Митохондрии — это крошечные структуры, расположенные почти во всех клетках тела. Это те части клетки, которые в первую очередь отвечают за выработку энергии.Они делают это, вырабатывая аденозинтрифосфат (АТФ), который является важным «топливом», которое управляет всеми функциями организма. По этой причине митохондрии часто называют «электростанцией» клетки.

    Рис. 1. На этом рисунке показан рисунок внутренней части ячейки. Митохондрии обведены красным. Здесь показаны только две митохондрии, но в одной клетке может быть до тысяч митохондрий.

    Клетки мозга и мышц относятся к числу тех, которым требуется много энергии, поэтому они имеют особенно высокую плотность митохондрий для удовлетворения своих энергетических потребностей.Когда митохондрии не работают должным образом, это часто те части тела, которые проявляют признаки плохой функции. Когда митохондрии не функционируют должным образом, может появиться широкий спектр симптомов, в том числе:

    • Задержка или регресс развития

    • Нарушение речи

    • Социальные нарушения

    • Умственная отсталость

      75

    • СДВГ, тревога, ОКР, депрессия)

    • Судороги

    • Головные боли

    • Нарушение слуха

    • Слабость

    • Малый рост

      966

    • 907 Эндокринные нарушения

    • и многие другие

    В настоящее время все больше и больше исследований показывают, что митохондриальная дисфункция может иметь значение при многих различных состояниях здоровья:

    Митохондриальная дисфункция и расстройство аутистического спектра

    90 002 Исследования митохондриальной дисфункции при РАС расширились в последние годы, и в настоящее время существует множество исследований, связывающих митохондриальную дисфункцию с РАС.

    В 2010 году новаторское исследование, проведенное учеными из Калифорнийского университета в Дэвисе, показало, что 80% детей с РАС, включенных в их исследование, имели анализы крови, указывающие на митохондриальную дисфункцию (1).

    Другие исследования обнаружили:

    • Биохимические доказательства митохондриальной дисфункции в посмертной мозговой ткани детей и взрослых с РАС (2, 3)

    • Маркеры митохондриальной дисфункции при сканировании с помощью МР-спектроскопии мозга. дети и взрослые с РАС (4)

    • Митохондриальные и иммунные нарушения у детей с РАС (5, 6)

    ‍Рисунок 2.Составные снимки МРТ головного мозга из исследования Goh et al, опубликованного в JAMA Psychiatry под названием «Митохондриальная дисфункция как нейробиологический подтип расстройства аутистического спектра: данные визуализации мозга». Области мозга, обведенные красными, желтыми и синими квадратами, являются области, где был обнаружен лактат (маркер митохондриальной дисфункции).

    Накопленные данные теперь свидетельствуют о том, что митохондриальная дисфункция присутствует у значительной части людей с РАС и что она может быть важным фактором, способствующим симптомам РАС.

    Триггеры митохондриальной дисфункции при РАС

    Множество различных типов триггеров могут приводить к митохондриальной дисфункции, и они могут приводить к симптомам РАС.

    Некоторые из триггеров включают:

    • мутации генов,

    • дефицит основных витаминов и минералов в рационе питания

    • определенные химические вещества, тяжелые металлы и лекарства

    • определенные бактерии и вирусы

    • стресс

    Митохондриальная дисфункция, таким образом, является потенциальным объяснением того, как различные типы воздействия окружающей среды могут приводить к симптомам РАС.Одна из теорий состоит в том, что определенные экологические оскорбления могут повлиять на людей с РАС, потому что у них уже есть основная генетическая уязвимость, которая в сочетании с экологическим оскорблением может привести к симптомам РАС.

    Диагностика митохондриальной дисфункции при ДМПП

    Существует множество различных тестов, которые могут быть выполнены для поиска признаков митохондриальной дисфункции. Некоторые общие тесты первой линии включают:

    • Анализ крови:

      Полный метаболический профиль (Chem 20), лактат, пируват, аминокислоты, креатинкиназа, аммиак, общий и свободный карнитин, ацилкарнитиновый профиль

    • Анализ мочи:

      органических кислот

    Визуализация мозга с помощью магнитно-резонансной спектроскопии (MRS) может показать повышенный уровень лактата (который является биомаркером митохондриальной дисфункции).

    При тестировании на митохондриальную дисфункцию важно помнить, что многие из доступных тестов имеют низкую чувствительность — это означает, что результаты могут казаться нормальными, даже если у человека есть митохондриальная дисфункция. Тестирование может потребоваться повторить несколько раз или может потребоваться провести при определенных физиологических условиях, например, во время голодания или во время болезни. Из-за этих проблем врач может порекомендовать лечение, даже если результаты анализов отрицательны, особенно если есть аспекты истории болезни человека, которые предполагают наличие митохондриальной дисфункции.

    Некоторые из особенностей анамнеза, которые могут поднять «красный флаг» для митохондриальной дисфункции, включают:

    • Плато развития или регресс, особенно в условиях болезни или другого физиологического стресса

    • Симптомы в более одной системы органов

    • Члены семьи с заболеваниями, которые были связаны с дисфункцией митохондрий

    • Болезнь Альцгеймера, болезнь Паркинсона, болезнь Хантингтона, болезнь Лу Герига (БАС), умственная отсталость, глухота, слепота, инсульт, мигрень головные боли

    • Диабет, ожирение, сердечно-сосудистые заболевания

    • Рассеянный склероз, волчанка, ревматоидный артрит

    Подход к лечению митохондриальной дисфункции

    Врачи могут рекомендовать несколько шагов для поддержки функции митохондрий.К ним относятся:

    • Ограничение периодов голодания, увеличение частоты приема пищи и улучшение гидратации

    • Избегание митохондриальных токсинов (например, вальпроевой кислоты, некоторых препаратов, снижающих уровень холестерина, аминогликозидных антибиотиков, ацетаминофена, метформина, бета-блокаторов. и т. д.)

    • По возможности избегайте физиологических стрессоров (например, болезни, обезвоживания, лихорадки, экстремальных температур, хирургического вмешательства, анестезии, длительного голодания или голодания), особенно в комбинации

    • Обеспечение поддерживающей помощи в условиях физиологического стресса (e .g., гидратация, питание, L-карнитин, CoQ10, витамины C и E, L-аргинин)

    • Постоянные умеренные упражнения

    Некоторые витамины и добавки также могут быть рекомендованы (и должны использоваться в соответствии с под наблюдением врача) (7):

    • L-карнитин — соединение, необходимое для транспортировки определенных жирных кислот в митохондрии, чтобы они могли окисляться («сжигаться») для производства энергии. Карнитин вырабатывается в печени и почках из аминокислот лизина и метионина.Некоторые люди не могут вырабатывать достаточно карнитина и зависят от добавок с пищей.

    • Витамин C — водорастворимый витамин, который естественным образом присутствует во многих продуктах питания. Витамин С является важным физиологическим антиоксидантом и, как было показано, восстанавливает другие антиоксиданты в организме, включая витамин Е. Он помогает противодействовать разрушающему воздействию свободных радикалов на клеточную и митохондриальную функцию.

    • Витамин Е — жирорастворимый витамин, имеющий множество различных химических форм.Альфа-токоферол — это форма витамина Е, которая, как считается, отвечает потребностям человека и является формой, наиболее часто встречающейся в добавках. Витамин Е является мощным антиоксидантом и помогает защитить клетки от разрушительного воздействия свободных радикалов.

    • Витамин B1 (тиамин) — водорастворимый витамин B-комплекса, который необходимо употреблять с пищей. Витамин B1 участвует во многих метаболических процессах, и его дефицит может вызвать серьезные неврологические симптомы, включая делирий, невропатию и нарушение сна.

    • Витамин B2 (рибофлавин) — водорастворимый витамин B-комплекса, необходимый для многих ферментативных реакций, протекающих в митохондриях. Источники витамина B2 включают молоко, сыр, листовые овощи, грибы и миндаль.

    • Витамин B3 (ниацин или ниацинамид) — водорастворимый витамин B-комплекса, дефицит которого может вызывать такие симптомы, как тошнота, анемия, головные боли и усталость.

    • Витамин B5 (пантотенат) — водорастворимый витамин B-комплекса, который необходим для синтеза кофермента-A, который играет важную роль в синтезе и окислении жирных кислот и в цикле Кребса.

    • Витамин B7 (биотин) — водорастворимый витамин, необходимый для роста клеток и метаболизма жиров и аминокислот.

    • Витамин B9 (фолиевая кислота) — водорастворимый витамин, который необходим для многих функций организма и должен поступать с пищей. Фолат играет важную роль в синтезе, репарации и метилировании ДНК и является кофактором многих биологических реакций. Дефицит фолиевой кислоты был связан с неврологическими дефектами развивающегося эмбриона.

    • Витамин B12 (кобаламин) — водорастворимый витамин, играющий ключевую роль в нормальном функционировании мозга и всей нервной системы. Витамин B12 играет важную роль в синтезе и регуляции ДНК, а также в метаболизме жирных кислот и метаболизме аминокислот.

    • L-креатин — органическая кислота, которая способствует образованию аденозинтрифосфата (АТФ) и тем самым помогает снабжать энергией все клетки тела, в частности, мышцы.Креатин вырабатывается в организме, а также потребляется с пищей (в основном из мясных продуктов).

    • Альфа-липоевая кислота — соединение, которое играет важную роль во многих различных аспектах аэробного метаболизма, включая цикл Кребса.

    • L-аргинин — аминокислота, которая вырабатывается в организме, но также должна потребляться с пищей для достижения достаточного количества. L-аргинин играет важную роль в делении клеток, заживлении ран, детоксикации, иммунной функции и высвобождении гормонов.

    • Селен — химический элемент, необходимый для функционирования клеток и компонент нескольких антиоксидантных ферментов.

    Важно работать с врачом для разработки правильного протокола лечения митохондрий. Типы добавок, которые могут быть полезны, их дозировка и продолжительность лечения должны контролироваться квалифицированным врачом. При неправильном применении некоторые витамины и добавки могут вызывать побочные эффекты.

    Результаты лечения для пациентов с РАС и митохондриальной дисфункцией

    Эффективность митохондриальных добавок при РАС еще не изучалась в крупномасштабных клинических испытаниях.Однако в одном исследовании изучалась эффективность приема L-карнитина у детей с РАС в течение трех месяцев и было обнаружено, что лечение привело к улучшению симптомов аутизма и увеличению мышечной силы (8). Число изученных детей было небольшим, и необходимы будущие исследования, чтобы понять, как митохондриальные добавки могут лучше всего использоваться для лечения детей с РАС.

    United Mitochondrial Disease Foundation предоставляет следующие сводные данные о потенциальных преимуществах терапии:

    Иногда лечение может быть полезным и сразу же отмечаться · Иногда для того, чтобы заметить преимущества лечения, может потребоваться несколько месяцев · Иногда преимущества лечения лечение может никогда не быть замеченным, но лечение может быть эффективным для отсрочки или остановки прогрессирования заболевания · Иногда некоторым пациентам терапия может не принести пользы.

    Для получения дополнительной информации о митохондриальной дисфункции перейдите по адресу:

    Ссылки

    1. Джуливи и др., Митохондриальная дисфункция при аутизме. Журнал Американской медицинской ассоциации . 2010; 304: 2389-2396.

    2. Чаухан и др., Специфический дефицит в области мозга в комплексах митохондриальной цепи транспорта электронов у детей с аутизмом. Журнал нейрохимии 2011; 117: 209-22.

    3. Тан и др., Митохондриальные аномалии в височной доле аутичного мозга. Нейробиология болезней 2013; 54: 349-361.

    4. Goh и др. Митохондриальная дисфункция как нейробиологический подтип расстройства аутистического спектра: данные визуализации головного мозга. JAMA Psychiatry 2014; 71: 665-671.

    5. Наполи и др., Дефицит биоэнергетики и нарушение иммунного ответа в гранулоцитах у детей с аутизмом. Педиатрия 2014; 133: e1405-10.

    6. Роуз и др., Окислительный стресс вызывает митохондриальную дисфункцию в подмножестве линий лимфобластоидных клеток аутизма в хорошо подобранной когорте случай-контроль. PLOS One 2014; 9: e85436.

    7. Парих и др. Современный подход к лечению митохондриальных заболеваний. Современные варианты лечения в неврологии. 2009; 11: 414-430.

    8. Гейер и др. Проспективное двойное слепое рандомизированное клиническое исследование левокарнитина для лечения расстройств аутистического спектра. Med Sci Monit 2011; 17: PI15-23.

    9. Руководство по митохондриальному тестированию и лечению от Университета Джона Хопкинса

    Frontiers | Митохондриальная дисфункция при болезни Хантингтона; Взаимодействие между факторами транскрипции HSF1, p53 и PGC-1α

    Введение

    Митохондрии являются критическими органеллами, которые контролируют выработку энергии, метаболизм липидов, а также передачу сигналов и буферизацию Ca 2+ . Снижение функции митохондрий вовлечено во множественные клеточные процессы, связывая дисфункциональные митохондрии с широким спектром заболеваний человека, включая метаболические, сердечно-сосудистые и неврологические нарушения (Ballinger, 2005; Lin and Beal, 2006; Bhatti et al., 2017). Конкретная роль митохондриальной дисфункции в контексте болезни Хантингтона (БХ) в последние годы была предметом многочисленных обзоров (Quintanilla, Johnson, 2009; Reddy et al., 2009; Jin and Johnson, 2010; Oliveira, 2010; Costa и Скоррано, 2012; Дубинский, 2017). Теперь новые открытия предоставили доказательства новой роли фактора транскрипции теплового шока 1 (HSF1) в прямом регулировании как функции митохондрий, так и патологии HD. Поэтому в этой статье мы обсуждаем молекулярные механизмы, которые вносят вклад в митохондриальную дисфункцию при HD, и размышляем о возможной роли HSF1 в опосредовании этого дефекта.

    HD представляет собой наследственное нейродегенеративное заболевание, вызванное экспансией триплетного (кодирующего глутамин) повтора CAG в гене хантингтина ( HTT ), которое вызывает неправильную укладку и агрегацию белка HTT (MacDonald, 1993; DiFiglia et al., 1997). HD проявляется прогрессирующими поведенческими и двигательными нарушениями, сопровождающимися снижением когнитивных функций. При БХ особенно уязвимы ГАМКергические средние шиповатые нейроны (MSN) полосатого тела. Прогрессирующая дисрегуляция MSN сильно коррелирует с началом двигательных симптомов и их тяжестью (Ferrante et al., 1991).

    Измененная морфология митохондрий является отличительной чертой HD, и в разных типах клеток можно увидеть различные аномалии. В периферических тканях (лимфобласты, миобласты и фибробласты) митохондрии имеют увеличенную морфологию, а нейроны характеризуются повышенной фрагментацией митохондрий (Panov et al., 2002; Squitieri et al., 2006, 2010; Kim et al., 2010; Jin et al., 2010; Jin et al. др., 2013). Измененная структура митохондрий коррелирует с митохондриальной дисфункцией во всех HD-клетках, что проявляется снижением активности цепи переноса электронов, потреблением кислорода, буферизацией Ca 2+ и снижением продукции АТФ и НАД + (Oliveira, 2010).Было высказано предположение, что опосредованные мутантным HTT (mHTT) митохондриальные аномалии значительно влияют на MSN из-за высокой потребности в энергии этого нейронального подтипа (Ferrante et al., 1991; Pickrell et al., 2011). Это одна из гипотез, которая объясняет повышенную уязвимость MSN при HD (Ferrante et al., 1991; Mitchell and Griffiths, 2003). В поддержку этой гипотезы митохондрии, выделенные из полосатого тела взрослых крыс, показали более высокую чувствительность к индуцированной Ca 2+ проницаемости мембраны, чем митохондрии из коры головного мозга, что позволяет предположить, что нейроны полосатого тела избирательно уязвимы к метаболическому стрессу (Brustovetsky et al., 2003). Другие факторы, которые способствуют этой клеточно-селективной невропатологии, включают: специфичный для клеточного типа процессинг или локализация mHTT (Li et al., 2000; Menalled et al., 2002), аномальные взаимодействия между mHTT и белками-партнерами, специфичными для области мозга, и тканеспецифические различия в нестабильности CAG (Kennedy et al., 2003; Goula et al., 2012). Все эти процессы играют важную роль в продвижении дегенерации MSN, и хотя они также могут способствовать увеличению митохондриального стресса, они не являются предметом этого обзора.

    пациентов с HD и мышиные модели HD демонстрируют хорошо описанные метаболические дефекты (Mochel and Haller, 2011; Mochel et al., 2012; Dubinsky, 2017). Метаболический анализ у бессимптомных пациентов с использованием позитронно-эмиссионной томографии (ПЭТ) и протонного ядерного магнитного резонанса (1H-ЯМР) показал, что поглощение глюкозы в полосатом теле и утилизация пирувата были снижены за годы до появления двигательных симптомов, что позволяет предположить, что митохондриальные изменения могут быть ранней причиной прогрессирования заболевания (Antonini et al., 1996; Фейгин и др., 2001). Другие исследования, проведенные на моделях мышей HD, показали, что дендритные изменения MSN появляются еще до того, как могут наблюдаться митохондриальные респираторные дефекты, что позволяет предположить, что дефицит энергии является следствием невропатологических изменений (Guidetti et al., 2001). Принято считать, что митохондриальная дисфункция как причина или как следствие играет ключевую роль в патогенезе и прогрессировании HD. В последние годы были предприняты огромные усилия по разработке терапевтических стратегий, направленных на улучшение функции митохондрий, например, направленных на стабилизацию митохондрий за счет увеличения производства АТФ, снижения проницаемости мембран и / или предотвращения окислительного повреждения (Reddy and Reddy, 2011; Corona and Duchen , 2016).

    Одна дополнительная функция митохондрий состоит в том, чтобы действовать как резервуар для проапоптотических факторов и, следовательно, регулировать гибель клеток (Suzuki et al., 1999; Dumollard et al., 2009). Дисфункция митохондрий, перегрузка Ca 2+ и накопление активных форм кислорода (АФК) вызывают открытие митохондриальной переходной поры проницаемости (mPTP). Открытие mPTP запускает внутренний апоптотический путь, связанный с проницаемостью внешней митохондриальной мембраны, высвобождением цитохрома с и активацией каспазы-3 (Choo et al., 2004; Quintanilla et al., 2017). Нарушение регуляции двух основных факторов транскрипции p53 и PGC-1α широко изучалось при HD на предмет их роли в обеспечении митохондриальной дисфункции, апоптоза и нейродегенерации (обзор Oliveira, 2010). Мы кратко рассмотрим эти механизмы действия и их перекрестные помехи и обсудим потенциальную роль HSF1 как конвергентного механизма, который интегрирует ответы, опосредованные p53 и PGC-1α.

    Роль p53 и PGC-1α в митохондриальной дисфункции

    Нарушение регуляции транскрипции и дисфункция митохондрий являются взаимосвязанными процессами при HD, регулируемыми перекрестными помехами между p53 и митохондриальным фактором биогенеза PGC-1α (коактиватор рецептора γ, активируемого пролифератором пероксисом 1α; Steffan et al., 2000; Джин и Джонсон, 2010).

    p53 представляет собой фактор транскрипции, известный своей ролью супрессора опухолей посредством регуляции нескольких генов-мишеней с различными биологическими функциями, включая остановку клеточного цикла, репарацию ДНК, метаболизм и апоптоз. Уровни и активность белка p53 индуцируются в головном мозге пациентов с HD и в клеточных и мышиных моделях HD 33 , что, по крайней мере частично, объясняет низкую заболеваемость опухолями, наблюдаемую у пациентов с HD (Sørensen et al., 1999; Bae et al. ., 2005). mHTT сильно взаимодействует с p53, и было высказано предположение, что такое взаимодействие нарушает рекрутирование E3-лигазы Mdm2, тем самым увеличивая стабилизацию p53 (Steffan et al., 2000; Bae et al., 2005). Повышающая регуляция p53 приводит к индуцированной экспрессии различных белков, связанных с митохондриями (например, Bax и Puma, связанных с митохондриальной деполяризацией) и активации апоптоза (Chipuk et al., 2004; La Spada and Morrison, 2005). Роль p53 в опосредовании митохондриальной дисфункции при HD была подтверждена, когда первичные нейроны, экспрессирующие mHTT, были обработаны ингибитором p53 пифитрином-α и показали улучшенный потенциал митохондриальной мембраны (MMP) и повышенную жизнеспособность клеток (Bae et al., 2005). Недавно было показано, что p53 также участвует в опосредовании связанного с митохондриями некроза и фрагментации в HD посредством прямого взаимодействия с белком деления митохондрий Drp1 (белок, связанный с динамином; Guo et al., 2013, 2014). Однако молекулярный механизм, с помощью которого ингибирование p53 вызывает нейрозащиту, все еще плохо изучен.

    PGC-1α представляет собой еще одну важную роль в связи между mHTT, нарушением регуляции транскрипции и дисфункцией митохондрий (Johri et al., 2013). PGC-1α является коактиватором транскрипции, который управляет экспрессией кодируемых ядром митохондриальных генов и регулирует несколько метаболических процессов, включая митохондриальный биогенез и окислительное фосфорилирование (Wu et al., 1999; Puigserver and Spiegelman, 2003). Поразительно, что PGC-1α нулевые мыши проявляют HD-подобные свойства, включая потерю нейронов полосатого тела, гипотермию и двигательные изменения (Weydt et al., 2006; Lucas et al., 2012). Экспрессия PGC-1α значительно подавляется в MSN по сравнению с другими клетками полосатого тела у пациентов с HD и моделей трансгенных мышей (Cui et al., 2006; Weydt et al., 2006). Нарушение экспрессии PGC-1α при HD обусловлено, по крайней мере частично, вмешательством mHTT в сигнальный путь CREB / TAF4 (Cui et al., 2006), который считается основным регулятором экспрессии PGC-1α (Herzig et al. др., 2001). Тем не менее, анализ иммунопреципитации хроматина, проведенный на полосообразных клетках мышей, полученных от мышей WT (ST Hdh Q7 ) и HD (ST Hdh Q111 ), не показал различий в связывании CREB / TAF4 с PGC-1α. промотор между двумя типами клеток (Cui et al., 2006), подтверждая, что дополнительные механизмы могут быть вовлечены в нарушение экспрессии PGC-1α (обсуждается в другом месте в этом обзоре).

    Подавление PGC-1α при HD сопровождается снижением экспрессии нескольких PGC-1α-зависимых мишеней и маркеров MSN (Weydt et al., 2006; Lucas et al., 2012). Исследования, направленные на индукцию экспрессии PGC-1α в трансгенных моделях HD, показали, что PGC-1α способствует не только биогенезу митохондрий, но также обеспечивает нейропротекторные эффекты, активируя аутофагию и увеличивая оборот агрегатов mHTT (Tsunemi et al., 2012). Эти исследования продемонстрировали важную роль PGC-1α в HD и стимулировали генерацию нескольких фармакологических активаторов из-за его терапевтического потенциала (обзор Johri et al., 2013).

    Однако недавний транскриптомный анализ, сравнивающий различные модели мышей HD с нулевыми мышами PGC-1α или мышами, лишенными PGC-1α в MSN, выявил множество различий между их профилями транскрипции, особенно в генах, связанных с митохондриями (Lucas et al., 2012; McMeekin et al. al., 2018). Неожиданно у мышей HD knock-in обнаружена повышенная регуляция нескольких PGC-1α-зависимых генов в зависимости от возраста. Эти данные предполагают, что необходимы дальнейшие исследования на других моделях мышей, чтобы прояснить точную роль PGC-1a в регуляции дисрегуляции митохондриальных генов при HD.

    В различных сообщениях предполагается, что p53 и PGC-1α могут действовать вместе, контролируя функцию митохондрий, хотя взаимосвязь между этими двумя факторами транскрипции различается в зависимости от физиологического контекста.Исследования на трансгенных мышах, сверхэкспрессирующих митохондриальную моноаминоксидазу-A (MAO-A), фермент, связанный с кардиомиопатиями, показали, что трансгенные сердца демонстрируют накопление p53 и подавление PGC-1α (Villeneuve et al., 2013), аналогично наблюдаемому в нейронах HD. Однако дополнительные исследования, проведенные на клетках нейробластомы SH-SY5Y при дефиците глутатиона, показали, что p53 связывается с промотором PGC-1α и положительно регулирует его экспрессию (Aquilano et al., 2013), тогда как в клетках карциномы печени Hep2G, p53 и PGC -1α-белки взаимодействуют друг с другом и модулируют свои функции трансактивации (Sen et al., 2011). Эти исследования подчеркивают сложность регуляторных механизмов этих двух факторов транскрипции и открывают возможность для альтернативных регуляторных путей, которые еще не описаны.

    HSF1 как физиологический регулятор активности митохондрий

    HSF1 хорошо известен как главный транскрипционный регулятор ответа на тепловой шок (Anckar and Sistonen, 2011). Однако в последнее десятилетие растет число исследований, в которых предполагается, что HSF1 является многогранным фактором, участвующим в регуляции многих различных клеточных процессов, включая, помимо прочего, пролиферацию клеток, воспаление, образование синапсов и энергетический метаболизм (обзор Gomez-Pastor и другие., 2017б). Здесь мы обсудим недавние исследования, которые привлекли внимание к HSF1 из-за его роли в митохондриальной функции и нейродегенерации.

    Бенджамин и его коллеги Ян и др. (2002) были первыми, кто сообщил о важной роли HSF1 в регуляции митохондриальной активности, изучая сердце мышей Hsf1 — / — . Их исследования показали, что недостаток HSF1 приводит к увеличению mPTP и увеличению продукции ROS. Дополнительные исследования ооцитов Hsf1 — / — подтвердили роль HSF1 в поддержании функции и целостности митохондрий за счет выявления ультраструктурных аномалий митохондрий, функциональных дефектов и активации апоптотического белка каспазы-3 (Bierkamp et al., 2010). Совсем недавно исследования гепатоцитов Hsf1 — / — также выявили снижение продукции ATP и NAD + и митохондриальные аномалии, связанные с измененной функцией Drp1 (Qiao et al., 2017). Однако, несколько неясно, регулируются ли эти митохондриальные изменения напрямую с помощью HSF1 или косвенно в результате понижающей регуляции шаперона.

    Очень элегантно, Накаи и его коллеги Тан и др. (2015) показали, что в первичных эмбриональных фибробластах мыши (MEF), подвергшихся воздействию протеотоксических стрессовых условий, HSF1 рекрутирует митохондриальный фактор SSBP1 (участвующий в репликации митохондриальной ДНК) в ядро, где они оба взаимодействуют для контроля экспрессии нескольких цитоплазматических / митохондриальные гены.Дальнейшие исследования раковых клеток также показали, что HSF1 напрямую регулирует экспрессию SMAC (митохондриальный активатор каспазы) и других митохондриальных генов, ингибирующих митохондриальный апоптоз (Liang et al., 2017). Эти исследования предлагают HSF1 как новый митохондриальный фактор транскрипции (Lee et al., 2015).

    Недостаток HSF1 также был связан со сниженным нейрогенезом, нейрональной демиелинизацией и тяжелым астроглиозом, что приводило к моторному и когнитивному дефициту у старых мышей (Santos and Saraiva, 2004; Homma et al., 2007; Uchida et al., 2011). Исследования жизнеспособности первичных кортикальных астроцитов и нейронов, выделенных от мышей Hsf1 — / — , подвергшихся различным условиям окислительного стресса, показали, что оба типа клеток были более чувствительны, чем клетки, выделенные от мышей WT. Окисление белков также выше в первичных культурах Hsf1 — / — (Homma et al., 2007). Эти результаты предполагают, что функция митохондрий может быть нарушена в разных типах клеток в головном мозге мышей Hsf1 — / — , хотя пока нет сообщений, посвященных этой проблеме.Остается неясным, вызваны ли нейрональные эффекты, наблюдаемые у HSF1 нулевых мышей, простым истощением шаперонов или напрямую связаны с HSF1-зависимой регуляцией транскрипции митохондриальных генов.

    Недавние исследования, проведенные на жировой ткани, показали, что HSF1 непосредственно активирует транскрипцию PGC-1α путем связывания с неканоническим элементом теплового шока (HSE), идентифицированным в его промоторной последовательности (Ma et al., 2015). Это исследование подчеркнуло потенциальную роль HSF1 в прямой регуляции функции митохондрий посредством регуляции PGC-1α.Известно, что жировая ткань от HSF1 нулевых мышей обнаруживает дефицит экспрессии митохондриальных генов (Ma et al., 2015). Однако отсутствие исследований транскрипции в этих клетках мешает определить, влияет ли отсутствие HSF1 специфически на PGC-1α-зависимую экспрессию гена. Чтобы ответить на этот вопрос, необходимы дальнейшие исследования, сравнивающие профили транскрипции мышей с нулевым HSF1 и мышей с нулевым PGC-1.

    С другой стороны, белки HSF1 и PGC-1α взаимодействуют и совместно локализуются на нескольких промоторах-мишенях HSF1, взаимодействуя в регуляции различных генов при гипертермии (Xu et al., 2016). Фактически, нулевые клетки PGC-1α показали подавление нескольких белков теплового шока, подобное тем, которые наблюдаются у мышей, нулевых по HSF1 (Trinklein et al., 2004; Xu et al., 2016). Интересно, что PGC-1α также действует как репрессор HSF1-опосредованной транскрипционной программы в гепатоцитах и ​​при раке (Minsky and Roeder, 2015). Следовательно, несмотря на доказательства, демонстрирующие перекрестные помехи между HSF1 и PGC-1α, регуляторные механизмы, которые контролируют взаимодействия PGC-1α и HSF1 в разных типах клеток или при заболеваниях, неясны.

    Роль HSF1 в опосредовании митохондриальной дисфункции при HD

    HSF1 играет фундаментальную роль в патогенезе HD (недавний обзор Gomez-Pastor et al., 2017b). Исследования, в которых мышей без HSF1 скрещивали с мышами R6 / 2, показали, что недостаток HSF1 ухудшает нейродегенерацию и прогрессирование заболевания (Hayashida et al., 2010), в то время как трансгенные мыши HD, сверхэкспрессирующие конститутивно активную форму HSF1, значительно облегчают симптомы HD (Fujimoto et al. ., 2005). Уровни HSF1 и его активность сильно истощены в полосатом теле пациентов с HD, а также в клеточных и мышиных моделях HD (Hay et al., 2004; Лаббадиа и др., 2011; Чафекар и Дуэнвальд, 2012; Рива и др., 2012; Махешвари и др., 2014; Gomez-Pastor et al., 2017a). Истощение HSF1 вызвано несоответствующей активацией MSN в двух белках, протеинкиназе CK2α ’и E3-лигазе Fbxw7, которые фосфорилируют и убиквитилируют HSF1, соответственно, передавая сигнал белку для протеасомной деградации (Gomez-Pastor et al., 2017a). Считается, что пониженные уровни и активность HSF1 способствуют дисфункции и патогенезу нейронов, что позволяет предположить, что HSF1 является потенциальной терапевтической мишенью для вмешательства HD (Sittler et al., 2001; Neef et al., 2011). Эта гипотеза подтверждается исследованиями нокаута аллеля CK2α ‘на мышиной модели HD KIQ175, которые привели к увеличению уровней HSF1 и экспрессии нейрональных шаперонов, восстановили морфологию MSN и образование синапсов, а также улучшили потерю веса, связанную с HD (Gomez-Pastor et al. ., 2017а).

    Благодаря предыдущим исследованиям, связывающим HSF1 с функцией митохондрий и экспрессией PGC-1α (описанным выше), разумно предположить, что истощение HSF1 также может вносить вклад в митохондриальную дисфункцию и аномалии, сообщаемые при HD.Текущие исследования в нашей лаборатории подтверждают эту гипотезу. Мы представляем здесь неопубликованные данные, оценивающие эффекты подавления HSF1 в MMP полосатого тела мыши S THdh Q7 клеток и то, как изменения MMP в этих условиях отражают дефицит, наблюдаемый в клетках, обработанных scramble ST Hdh Q111 (рис. ). Влияние на ММП определяли с помощью теста JC-1, флуоресцентного красителя, который различает активированные (красный JC-1) и деполяризованные (зеленый JC-1) митохондрии.Мы наблюдали повышенную деполяризацию митохондрий (определяемую соотношением сигналов JC-1 красный / JC-1 зеленый) в клетках ST Hdh Q111 по сравнению с клетками ST Hdh Q7 , как описано ранее (Ruan et al., 2004 ; Рисунок 1A). Что еще более важно, подавление HSF1 в клетках ST Hdh Q7 приводило к сильной митохондриальной деполяризации по сравнению с скремблированием, аналогично результатам, полученным в необработанных клетках ST Hdh Q111 . Анализ жизнеспособности клеток с использованием анализа CyQUANT XTT (Thermo Fisher X12223) продемонстрировал, что снижение MMP в клетках ST Hdh Q7 , обработанных siHSF1, не является вторичным по отношению к гибели клеток, поскольку не наблюдалось значительных изменений между условиями scramble и siHSF1 (рис. 1B).Напротив, жизнеспособность клеток была снижена в клетках ST Hdh Q111 по сравнению с клетками ST Hdh Q7 , как ранее описано с использованием аналогичных анализов (Singer et al., 2017). Этот дефект усугублялся при подавлении HSF1. Эти данные свидетельствуют о том, что дисфункция митохондрий способствует обострению фенотипа HD, хотя этого недостаточно, чтобы вызвать гибель клеток.

    Рисунок 1 . Фактор транскрипции теплового шока 1 (HSF1) регулирует потенциал митохондриальной мембраны (MMP) в клетках полосатого тела. (A, B) Иммортализованное полосатое тело мыши S THdh Q7 и ST Hdh Q111 Клетки трансфицировали скремблом (Scr .; Santa Cruz, sc-37007) или 5 мкМ siHSF1 (Santa Cruz, sc. -35612). Через 24 ч клетки инкубировали с 5 мкМ красителя JC-1 (Invitrogen T3168) в течение 30 мин при 37 ° C в PBS. ММП определяли путем измерения интенсивности флуоресценции при возбуждении 550 нм, испускании 600 нм для красной флуоресценции (возбужденные митохондрии) и при возбуждении 485 нм и испускании 535 нм для зеленой флуоресценции (деполяризованные митохондрии).Показаны репрезентативные флуоресцентные изображения. Отношение красной / зеленой флуоресценции рассчитывали для каждого условия, и уровни относились к клеткам S THdh Q7 . Всего было проведено три независимых эксперимента. (C) Жизнеспособность клеток определяли количественно с использованием CYQUANT XTT (ThermoFisher, X12223) через 24 часа трансфекции scr. или siHSF1 в соответствии с инструкциями производителя. Статистический анализ проводился с использованием теста T , * p -значение <0.05, ** p <0,01, n.s. (никаких существенных).

    Снижение ММП в клетках ST Hdh Q7 , обработанных siHSF1, сопровождалось снижением уровней PGC-1α (рис. 2А). Затем мы провели анализ иммунопреципитации хроматина HSF1 на промоторе PGC-1α. Мы продемонстрировали, что HSF1 связывается с неканоническим HSE, присутствующим в промоторе PGC-1α как в клетках ST Hdh Q7 , так и в ST Hdh Q111 (Фигуры 2B, C).Однако связывание HSF1 было снижено в клетках ST Hdh Q111 (рис. 2C), что коррелирует с ранее сообщенным истощением HSF1 и сниженной экспрессией PGC-1α в тех же самых клетках (Cui et al., 2006; Chafekar and Duennwald , 2012; Gomez-Pastor et al., 2017a). В соответствии с тем, что HSF1 играет роль в регуляции PGC-1α, сверхэкспрессия HSF1 в клетках ST Hdh Q111 спасает экспрессию PGC-1α (рис. 2D). Эти результаты предполагают, что истощение уровней белка HSF1 при HD (Gomez-Pastor et al., 2017a) может быть ответственным, по крайней мере частично, за нарушение экспрессии PGC-1α. В поддержку этой гипотезы мы ранее наблюдали, что повышение уровней HSF1 в полосатом теле мышей HD увеличивает экспрессию PGC-1α и его нижележащих мишеней, таких как цитохром c и митохондриальный фактор транскрипции TFAM (Gomez-Pastor et al., 2017а). Все эти данные подтверждают роль деградации HSF1 в нарушении регуляции митохондрий при HD. Однако дальнейшие эксперименты in vivo будут необходимы для установления прямой связи между истощением HSF1, митохондриальной недостаточностью и подавлением PGC-1α при HD.

    Рисунок 2 . HSF1 связывается с промотором PGC-1α и регулирует его экспрессию в клетках болезни Хантингтона (HD). (A) Вестерн-блоттинг клеток S THdh Q7 , обработанных скремблированием (Scr.) Или миРНК в течение 24 часов. Лизаты клеток готовили в буфере для лизиса (25 мМ Трис pH 7,5, 150 мМ NaCl, 1 мМ EDTA, 1% Triton X-100, 0,1% SDS) и загружали всего 25 мкг белка. (B) Схема промотора PGC-1α, содержащего неканонический элемент теплового шока (HSE *; Ma et al., 2015). (C) Иммунопреципитация хроматина HSF1 в клетках S THdh Q7 и ST Hdh Q111 с использованием 1 мкг антитела против HSF1 (Bethyl Laboratories, A303-176A) и праймеров, описанных Ma et al. (2015; прямой TTCATGGATGTGCTGGGTTA, обратный TTACAGATGGTTGCTTGCACT) для промотора PGC-1α (Ma et al., 2015). Полученные значения были нормализованы с использованием% введенного и кратного обогащения над IgG (отрицательный контроль) для каждого штамма. Затем данные выражали как связывание с изменением кратности связывания относительно клеток S THdh Q7 . (D) qRT-PCR для экспрессии PGC-1α (прямой ATGTGTCGCCTTCTTGCTCT, обратный ATCTACTGCCTGGGGACCTT), проведенный через 36 часов после трансфекции плазмидой с избыточной экспрессией пустой pcDNA или HSF1-pcDNA. Для каждого анализа проводилось не менее трех независимых экспериментов. Статистический анализ проводили с использованием T -тест, * p -значение <0,05. * p -значение <0,05 (по сравнению с STHdhQ7-pcDNA), # p -значение <0,05 (по сравнению с STHdhQ7-HSF1).

    Перекрестные помехи между HSF1 и осью p53-PGC1α

    В различных отчетах выявлено перекрестное взаимодействие HSF1 с путем p53 за счет прямого регулирования стабилизации p53 и ядерной транслокации (Li et al., 2008; Jin et al., 2009; Logan et al., 2009; Oda et al., 2018; Рисунок 3). ). В диплоидных фибробластах человека острое истощение HSF1 вызывает клеточное старение независимо от опосредованного шапероном гомеостаза белка, но зависит от активации пути p53-p21. Частично это связано с повышенной экспрессией дегидрогеназы / редуктазы 2 (DHRS2), предполагаемого ингибитора MDM2.MDM2 регулирует деградацию p53, и его ингибирование способствует повышению уровня p53 и активации апоптоза (Oda et al., 2018). Другое исследование также сообщило о повышенных уровнях p53 в Hsf1 — / — MEFs (Jin et al., 2009). Однако авт. Предложили альтернативный HSF1-зависимый механизм повышения уровня p53. Они показали, что αβ-кристаллин, мишень для гена HSF1, необходим для рекрутирования E3-лигазы Fbx4, которая убиквитилирует p53 и контролирует деградацию p53. В отсутствие HSF1 снижение уровня αβ-кристаллина приводит к стабилизации p53.

    Рисунок 3 . Модель интегрированных ответов p53-HSF1-PGC1α при HD. Перекрестные помехи между факторами транскрипции p53, HSF1 и PGC-1α регулируют транскрипцию, гомеостаз белков, функцию митохондрий и апоптоз. Различные пути (CREB / TAF4, CK2α ’/ Fbxw7 и Mdm2) изменяются в присутствии мутантного HTT (mHTT), что независимо приводит к нарушению регуляции уровней и функций всех трех факторов транскрипции. Однако HSF1 становится ключевым игроком в последующей регуляции уровней как p53, так и PGC-1α, напрямую регулируя транскрипцию PGC-1α и контролируя стабильность белка p53 при HD.Потенциальная роль p53 в регуляции пути деградации HSF1 при HD может добавить положительную обратную связь в ось p53-HSF1-PGC-1α, запускающую митохондриальную дисфункцию и гибель нейронов.

    С другой стороны, было показано, что p53 непосредственно регулирует экспрессию E3-лигазы Fbxw7 человека путем связывания с регуляторными элементами, содержащимися в кодирующей последовательности Fbxw7 (Kimura et al., 2003; Mao et al., 2004). Поскольку Fbxw7 участвует в убиквитилировании HSF1 (Kourtis et al., 2015; Gomez-Pastor et al., 2017a) возможно, что повышенные уровни p53 при HD участвуют в деградации HSF1 путем активации Fbxw7 во время прогрессирования заболевания. Если эта гипотеза верна, это установит порочный круг, в котором истощение HSF1 способствует стабилизации уровней p53, что, в свою очередь, потенцирует деградацию HSF1 (Рисунок 3).

    Как мы ранее обсуждали, пути p53 и PGC-1α также являются взаимосвязанными процессами, когда уровни одного фактора влияют на уровни и активность другого (Sen et al., 2011; Аквилано и др., 2013; Villeneuve et al., 2013). Принимая во внимание все доказательства, которые связывают HSF1, p53 и PGC-1α, мы предполагаем существование оси p53-HSF1-PGC-1α, которая объединяет дисрегуляцию транскрипции и дисфункцию митохондрий в один единственный путь (Рисунок 3). Однако необходимо будет провести дальнейшие исследования, чтобы собрать воедино все части головоломки и связать эти три фактора транскрипции в контексте HD.

    Направления будущего

    В настоящее время многочисленные исследования продемонстрировали роль HSF1 в регуляции митохондриальной дисфункции в различных контекстах, включая HD.Однако многие вопросы остаются нерешенными. Во-первых, было бы необходимо выяснить, является ли повышение уровня p53 ответственным за деградацию HSF1 при HD и действительно ли нейрозащита, вызываемая ингибированием p53, опосредуется через HSF1. С другой стороны, прямая роль HSF1 в регуляции экспрессии PGC-1α при HD и последствия такой регуляции для митохондриальной дисфункции в нейронах нуждаются в дальнейшем подтверждении в других системах. Эти исследования будут иметь решающее значение для полного понимания причин и последствий деградации HSF1 при HD и помогут разработать более эффективные терапевтические стратегии вмешательства при HD.

    Доступность данных

    Все наборы данных, созданные для этого исследования, включены в рукопись.

    Авторские взносы

    TI проводил эксперименты и участвовал в написании, подготовке литературы и рецензировании рукописи. EM проводил эксперименты, показанные на рисунке 1, и участвовал в рецензировании рукописи. RG-P участвовал в написании рукописи, подготовке литературы и проводил эксперименты, показанные в рукописи.

    Финансирование

    Мы благодарим Программу возможностей исследований бакалавриата Миннесотского университета (UROP; TI) и R25 NS083059 Летние исследования в области нейробиологии (EM) Университета Миннесоты за их поддержку и источники финансирования.

    Заявление о конфликте интересов

    Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

    Благодарности

    Благодарим Дахён Ю и Николь Зарате за техническую поддержку.

    Список литературы

    Анкар Дж. И Систонен Л. (2011). Регуляция функции HSF1 в ответе на тепловой стресс: влияние на старение и болезни. Annu. Rev. Biochem. 80, 1089–1115. DOI: 10.1146 / annurev-biochem-060809-095203

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Антонини А., Лендерс К. Л., Шпигель Р., Мейер Д., Вонтобель П., Вайгель-Вебер М. и др. (1996). Метаболизм глюкозы в полосатом теле и связывание с рецептором дофамина D2 у бессимптомных носителей гена и пациентов с болезнью Хантингтона. Мозг 119, 2085–2095. DOI: 10.1093 / мозг / 119.6.2085

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Аквилано, К., Балделли, С., Паглией, Б., Канната, С. М., Ротилио, Г., и Чириоло, М. Р. (2013). p53 управляет антиоксидантным ответом, опосредованным PGC-1α, при умеренном окислительно-восстановительном и метаболическом дисбалансе. Антиоксид. Редокс-сигнал. 18, 386–399. DOI: 10.1089 / ars.2012.4615

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Бэ Б. И., Сюй Х., Игараши С., Фуджимуро М., Агравал Н., Тая Ю. и др. (2005). p53 опосредует клеточную дисфункцию и поведенческие аномалии при болезни Хантингтона. Нейрон 47, 29–41. DOI: 10.1016 / j.neuron.2005.06.005

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Бхатти, Дж. С., Бхатти, Г. К., и Редди, Х. (2017). Дисфункция митохондрий и окислительный стресс при метаболических нарушениях — шаг к терапевтическим стратегиям, основанным на митохондриях. Biochim. Биофиз. Acta Mol. Основы дис. 1863, 1066–1077. DOI: 10.1016 / j.bbadis.2016.11.010

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Биркамп, К., Luxey, M., Metchat, A., Audouard, C., Dumollard, R., and Christians, E. (2010). Отсутствие материнского фактора теплового шока 1 приводит к множественным клеточным дефектам и дефектам развития, включая повреждение митохондрий и измененный окислительно-восстановительный гомеостаз, и приводит к снижению выживаемости ооцитов и эмбрионов млекопитающих. Dev. Биол. 339, 338–353. DOI: 10.1016 / j.ydbio.2009.12.037

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Бустовецкий, Н., Брустовецкий, Т., Пурль, К. Дж., Капано, М., Кромптон, М., и Дубински, Дж. М. (2003). Повышенная восприимчивость митохондрий полосатого тела к изменению проницаемости, вызванному кальцием. J. Neurosci. 23, 4858–4867. DOI: 10.1523 / jneurosci.23-12-04858.2003

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Чафекар, С. М., Дуэнвальд, М. Л. (2012). Нарушение реакции теплового шока в клетках, экспрессирующих полноразмерный полиглутамин-расширенный хантингтин. PLoS One 7: e37929. DOI: 10,1371 / журнал.pone.0037929

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Chipuk, J. E., Kuwana, T., Bouchier-Hayes, L., Droin, N. M., Newmeyer, D. D., Schuler, M., et al. (2004). Прямая активация Bax p53 опосредует проницаемость митохондриальной мембраны и апоптоз. Наука 303, 1010–1014. DOI: 10.1126 / science.10

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Чу, Ю.С., Джонсон, Г.В., Макдональд, М., Детлофф, П.Дж., И Лесорт, М. (2004). Мутантный хантингтин напрямую увеличивает восприимчивость митохондрий к индуцированному кальцием переходу проницаемости и высвобождению цитохрома с. Hum. Мол. Genet. 13, 1407–1420. DOI: 10.1093 / hmg / ddh262

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Корона, Дж. К., Дюшен, М. Р. (2016). PPARγ как терапевтическая мишень для восстановления функции митохондрий при неврологических заболеваниях. Free Radic. Биол. Med. 100, 153–163.DOI: 10.1016 / j.freeradbiomed.2016.06.023

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Цуй, Л., Чон, Х., Боровецки, Ф., Паркхерст, К. Н., Танезе, Н., и Крейнц, Д. (2006). Репрессия транскрипции PGC-1α мутантным гентингтином приводит к митохондриальной дисфункции и нейродегенерации. Cell 127, 59–69. DOI: 10.1016 / j.cell.2006.09.015

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    ДиФилья, М., Сапп, Э., Чейз, К.О., Дэвис, С. В., Бейтс, Г. П., Вонсаттель, Дж. П. и др. (1997). Агрегация хантинтина в нейрональных внутриядерных включениях и дистрофических нейритах головного мозга. Наука 277, 1990–1993. DOI: 10.1126 / science.277.5334.1990

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Думоллард Р., Кэрролл Дж., Дюшен М. Р., Кэмпбелл К. и Суонн К. (2009). Функция митохондрий и окислительно-восстановительное состояние эмбрионов млекопитающих. Семин. Cell Dev. Биол. 20, 346–353.DOI: 10.1016 / j.semcdb.2008.12.013

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Фейгин А., Лендерс К. Л., Мёллер Дж. Р., Миссимер Дж., Кёниг Г., Специерис П. и др. (2001). Нарушения метаболической сети при ранней стадии болезни Хантингтона: исследование [(18) F] FDG PET. J. Nucl. Med. 42, 1591–1595.

    PubMed Аннотация | Google Scholar

    Ферранте Р. Дж., Ковалл Н. У. и Ричардсон Э. П. (1991). Пролиферативные и дегенеративные изменения в нейронах шипов полосатого тела при болезни Хантингтона: комбинированное исследование с использованием метода сечения-Гольджи и иммуноцитохимии кальбиндина D28k. J. Neurosci. 11, 3877–3887. DOI: 10.1523 / jneurosci.11-12-03877.1991

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Fujimoto, M., Takaki, E., Hayashi, T., Kitaura, Y., Tanaka, Y., Inouye, S., et al. (2005). Активный HSF1 значительно подавляет образование агрегатов полиглутамина в клеточных и мышиных моделях. J. Biol. Chem. 280, 34908–34916. DOI: 10.1074 / jbc.m506288200

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Гомес-Пастор, Р., Burchfiel, E. T., Neef, D. W., Jaeger, A. M., Cabiscol, E., McKinstry, S.U., et al. (2017a). Аномальная деградация нейронального стресс-защитного фактора транскрипции HSF1 при болезни Хантингтона. Нат. Commun. 8: 14405. DOI: 10.1038 / ncomms14405

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Гомес-Пастор Р., Бурчфил Э. Т. и Тиле Д. Дж. (2017b). Регулирование факторов транскрипции теплового шока и их роль в физиологии и болезнях. Нат.Rev. Mol. Cell Biol. 19, 4–19. DOI: 10.1038 / nrm.2017.73

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Гула, А. В., Стис, А., Чан, Дж. П., Троттье, Ю., Фестенштейн, Р., Мериен, К. (2012). Элонгация транскрипции и тканеспецифическая соматическая нестабильность CAG. PLoS Genet. 8: e1003051. DOI: 10.1371 / journal.pgen.1003051

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Гвидетти П., Чарльз В., Чен Э.Y., Reddy, P.H., Kordower, J.H., Whetsell, W.O.Jr. и др. (2001). Ранние дегенеративные изменения у трансгенных мышей, экспрессирующих мутантный гентингтин, связаны с дендритными аномалиями, но без нарушения производства энергии митохондриями. Exp. Neurol. 169, 340–350. DOI: 10.1006 / exnr.2000.7626

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Го X., Дисатник М. Х., Монбюро М., Шамлоо М., Мочли-Розен Д. и Ци X. (2013). Ингибирование митохондриальной фрагментации снижает нейродегенерацию, связанную с болезнью Хантингтона. J. Clin. Инвестировать. 123, 5371–5388. DOI: 10.1172 / jci70911

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Го X., Сесаки Х. и Ци X. (2014). Drp1 стабилизирует p53 на митохондриях, чтобы вызвать некроз в условиях окислительного стресса in vitro и in vivo . Biochem. J. 461, 137–146. DOI: 10.1042 / bj20131438

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Хэй, Д. Г., Сатхасивам, К., Tobaben, S., Stahl, B., Marber, M., Mestril, R., et al. (2004). Прогрессивное снижение уровней шаперонового белка на мышиной модели болезни Хантингтона и индукция стрессовых белков в качестве терапевтического подхода. Hum. Мол. Genet. 13, 1389–1405. DOI: 10,1093 / hmg / ddh244

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Хаясида, Н., Фудзимото, М., Тан, К., Пракасам, Р., Шинкава, Т., Ли, Л. и др. (2010). Фактор теплового шока 1 снижает протеотоксичность в сочетании с фактором транскрипции NFAT. EMBO J. 29, 3459–3469. DOI: 10.1038 / emboj.2010.225

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Херциг, С., Лонг, Ф., Джхала, США, Хедрик, С., Куинн, Р., Бауэр, А. и др. (2001). CREB регулирует глюконеогенез в печени через коактиватор PGC-1. Природа 413, 179–183. DOI: 10.1038 / 35093131

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Хомма, С., Джин, X., Ван, Г., Ту, Н., Мин, Дж., Янасак, Н., и другие. (2007). Демиелинизация, астроглиоз и накопление убиквитинированных белков, признаки заболевания ЦНС у мышей с дефицитом hsf1. J. Neurosci. 27, 7974–7986. DOI: 10.1523 / jneurosci.0006-07.2007

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Джин, Ю. Н., Джонсон, Г. (2010). Взаимосвязь между дисфункцией митохондрий и нарушением регуляции транскрипции при болезни Хантингтона. J. Bioenerg. Биомембр. 42, 199–205. DOI: 10.1007 / с10863-010-9286-7

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Джин, X., Москофидис, Д., Ху, Ю., Филлипс, А., и Мивечи, Н. Ф. (2009). Дефицит фактора теплового шока 1 через его расположенный ниже целевой ген αB-кристаллин (Hspb5) нарушает деградацию p53. J. Cell. Biochem. 107, 504–515. DOI: 10.1002 / jcb.22151

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Джин, Ю. Н., Ю, Ю. В., Гундемир, С., Джо, К., Цуй, М., Тиеу, К., и другие. (2013). Нарушенная митохондриальная динамика и передача сигналов Nrf2 вносят вклад в скомпрометированные ответы на окислительный стресс в клетках полосатого тела, экспрессирующих полноразмерный мутантный хантингтин. PLoS One 8: e57932. DOI: 10.1371 / journal.pone.0057932

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Джори А., Чандра А. и Флинт Бил М. (2013). PGC-1α, митохондриальная дисфункция и болезнь Хантингтона. Free Radic. Биол. Med. 62, 37–46. DOI: 10.1016 / j.freeradbiomed.2013.04.016

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Кеннеди, Л., Эванс, Э., Чен, К. М., Крейвен, Л., Детлофф, П. Дж., Эннис, М. и др. (2003). Резкое увеличение длины тканеспецифичных мутаций является ранним молекулярным событием в патогенезе болезни Хантингтона. Hum. Мол. Genet. 12, 3359–3367. DOI: 10.1093 / hmg / ddg352

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ким, Дж., Муди, Дж. П., Эджерли, К.К., Бордюк, О. Л., Кормье, К., Смит, К. и др. (2010). Митохондриальная потеря, дисфункция и изменение динамики при болезни Хантингтона. Hum. Мол. Genet. 19, 3919–3935. DOI: 10.1093 / hmg / ddq306

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Кимура Т., Гото М., Накамура Ю. и Аракава Х. (2003). hCDC4b, регулятор циклина E, в качестве прямой транскрипционной мишени р53. Cancer Sci. 94, 431–436. DOI: 10.1111 / j.1349-7006.2003.tb01460.х

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Куртис Н., Мубарак Р. С., Аранда-Оргиллес Б., Луи К., Айдин И. Т., Тримарчи Т. и др. (2015). FBXW7 модулирует клеточную стрессовую реакцию и метастатический потенциал посредством посттрансляционной модификации HSF1. Нат. Cell Biol. 17, 322–332. DOI: 10.1038 / ncb3121

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ла Спада А. Р. и Моррисон Р. С. (2005). Сила темной стороны: белок болезни Хантингтона и р53 образуют смертельный союз. Нейрон 47, 1–3. DOI: 10.1016 / j.neuron.2005.06.023

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Лаббадиа Дж., Канлифф Х., Вайс А., Кацюба Э., Сатхасивам К., Середенина Т. и др. (2011). Измененная архитектура хроматина лежит в основе прогрессирующего нарушения реакции теплового шока в мышиных моделях болезни Хантингтона. J. Clin. Инвестировать. 121, 3306–3319. DOI: 10.1172 / jci57413

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ли, Дж.Х., Ли, Ю. К., Лим, Дж. Дж., Бьюн, Х. О., Пак, И., Ким, Г. Х. и др. (2015). Митохондриальная респираторная дисфункция индуцирует экспрессию клаудина-1 через активацию фактора теплового шока 1, опосредованную активными формами кислорода, что приводит к инвазивности клеток гепатомы. J. Biol. Chem. 290, 21421–21431. DOI: 10.1074 / jbc.m115.654913

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ли К., Фельдман Р. А., Радхакришнан В. М., Кэри С. и Мартинез Дж. Д. (2008). Hsf1 необходим для ядерной транслокации опухолевого супрессора p53. Неоплазия 10, 1138–1145. DOI: 10.1593 / neo.08430

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ли, Х., Ли, С. Х., Джонстон, Х., Шелбурн, П. Ф., и Ли, Х. Дж. (2000). Амино-концевые фрагменты мутантного хантингтина проявляют избирательное накопление в нейронах полосатого тела и синаптическую токсичность. Нат. Genet. 25, 385–389. DOI: 10.1038 / 78054

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Лян В., Ляо Ю., Чжан Дж., Хуанг, К., Луо, В., Ю, Дж. И др. (2017). Фактор теплового шока 1 ингибирует путь митохондриального апоптоза, регулируя второй митохондриальный активатор каспазы, способствующий онкогенезу поджелудочной железы. J. Exp. Clin. Cancer Res. 36:64. DOI: 10.1186 / s13046-017-0537-x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Логан И. Р., Макнейл Х. В., Кук С., Лу X., Мик Д. У., Фуллер-Пейс Ф. В. и др. (2009). Фактор теплового шока-1 модулирует активность р53 в ответе транскрипции на повреждение ДНК. Nucleic Acids Res. 37, 2962–2973. DOI: 10.1093 / nar / gkp180

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Лукас, Э. К., Догерти, С. Э., МакМикин, Л. Дж., Трин, А. Т., Рид, С. С. и Коуэлл, Р. М. (2012). Изменения в развитии моторной координации и маркеры средних шиповатых нейронов у мышей, лишенных pgc-1α. PLoS One 7: e42878. DOI: 10.1371 / journal.pone.0042878

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    млн лет назад, X., Сюй Л., Альберобелло А. Т., Гаврилова О., Багаттин А., Скарулис М. и др. (2015). Целастрол защищает от ожирения и метаболической дисфункции за счет активации оси транскрипции HSF1-PGC1α. Cell Metab. 22, 695–708. DOI: 10.1016 / j.cmet.2015.08.005

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Макдональд, М. (1993). Новый ген, содержащий тринуклеотидный повтор, который размножается и нестабилен на хромосомах болезни Хантингтона. Совместная исследовательская группа по болезни Хантингтона. Cell 72, 971–983. DOI: 10.1016 / 0092-8674 (93)

    -e

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Махешвари М., Бутани С., Дас А., Мукерджи Р., Шарма А., Кино Ю. и др. (2014). Дексаметазон вызывает реакцию теплового шока и замедляет прогрессирование болезни у мышей и мух, моделирующих болезнь Хантингтона. Hum. Мол. Genet. 23, 2737–2751. DOI: 10.1093 / hmg / ddt667

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Мао, Дж.Х., Перес-Лосада, Дж., Ву, Д., Делросарио, Р., Цунемацу, Р., Накаяма, К. И. и др. (2004). Fbxw7 / Cdc4 представляет собой p53-зависимый гаплонедостаточный ген-супрессор опухоли. Природа 432, 775–779. DOI: 10.1038 / nature03155

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    МакМикин, Л. Дж., Ли, Ю., Фокс, С. Н., Роу, Г. К., Кроссман, Д. К., Дэй, Дж. Дж. И др. (2018). Клеточно-специфическое удаление PGC-1? из средних колючих нейронов вызывает транскрипционные изменения и возрастные двигательные нарушения. J. Neurosci. 38, 3273–3286. DOI: 10.1523 / jneurosci.0848-17.2018

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Menalled, L. B., Sison, J. D., Wu, Y., Olivieri, M., Li, X.J., Li, H., et al. (2002). Ранняя моторная дисфункция и стриосомное распределение микроагрегатов хантингтина у мышей, пораженных болезнью Хантингтона. J. Neurosci. 22, 8266–8276. DOI: 10.1523 / JNEUROSCI.22-18-08266.2002

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Минский, Н.и Редер Р. Г. (2015). Прямая связь между регуляцией метаболизма и ответом на тепловой шок через регулятор транскрипции PGC-1α. Proc. Natl. Акад. Sci. U S A 112, E5669 – E5678. DOI: 10.1073 / pnas.1516219112

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Митчелл И. Дж. И Гриффитс М. Р. (2003). Дифференциальная восприимчивость конкретных популяций нейронов: выводы из болезни Хантингтона. IUBMB Life 55, 293–298.DOI: 10.1080 / 1521654031000153012

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Mochel, F., Durant, B., Meng, X., O’Callaghan, J., Yu, H., Brouillet, E., et al. (2012). Ранние изменения гомеостаза клеточной энергии мозга на моделях болезни Хантингтона. J. Biol. Chem. 287, 1361–1370. DOI: 10.1074 / jbc.m111.309849

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ниф Д. В., Джегер А. М. и Тиле Д. Дж. (2011).Фактор транскрипции теплового шока 1 как терапевтическая мишень при нейродегенеративных заболеваниях. Нат. Rev. Drug Discov. 10, 930–944. DOI: 10.1038 / nrd3453

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ода, Т., Секимото, Т., Курашима, К., Фудзимото, М., Накаи, А., Ямасита, Т. (2018). Острое истощение HSF1 вызывает клеточное старение посредством пути MDM2 – p53-p21 в диплоидных фибробластах человека. J. Cell Sci. 131: jcs210724. DOI: 10.1242 / jcs.210724

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Оливейра, Дж. М. (2010). Природа и причина митохондриальной дисфункции при болезни Хантингтона: основное внимание уделяется хантинтину и полосатому телу. J. Neurochem. 114, 1–12. DOI: 10.1111 / j.1471-4159.2010.06741.x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Панов, А. В., Гутекунст, К. А., Ливит, Б. Р., Хайден, М. Р., Берк, Дж. Р., Стритматтер, В. Дж. И др. (2002). Ранние митохондриальные нарушения кальция при болезни Хантингтона являются прямым эффектом полиглутаминов. Нат. Neurosci. 5, 731–736. DOI: 10.1038 / nn884

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Пикрелл А. М., Фукуи Х., Ван Х., Пинто М. и Мораес К. Т. (2011). Стриатум очень чувствителен к дисфункции митохондриального окислительного фосфорилирования. J. Neurosci. 31, 9895–9904. DOI: 10.1523 / JNEUROSCI.6223-10.2011

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Пуигсервер, П., и Шпигельман, Б.М. (2003). Коактиватор 1 α рецептора, активируемого пролифератором пероксисом (PGC-1 α): коактиватор транскрипции и регулятор метаболизма. Endocr. Ред. 24, 78–90. DOI: 10.1210 / er.2002-0012

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Цяо, А., Цзинь, X., Панг, Дж., Москофидис, Д., и Мивечи, Н. Ф. (2017). Регулятор транскрипции шаперонного ответа HSF1 контролирует биоэнергетику печени и гомеостаз белков. J. Cell Biol. 216, 723–741.DOI: 10.1083 / jcb.201607091

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Кинтанилья, Р. А., Джонсон, Г. (2009). Роль митохондриальной дисфункции в патогенезе болезни Хантингтона. Brain Res. Бык. 80, 242–247. DOI: 10.1016 / j.brainresbull.2009.07.010

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Кинтанилья Р. А., Тапиа К. и Перес М. Дж. (2017). Возможная роль переходной поры митохондриальной проницаемости в патогенезе болезни Хантингтона. Biochem. Биофиз. Res. Commun. 483, 1078–1083. DOI: 10.1016 / j.bbrc.2016.09.054

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Редди, Х., Мао, П., и Манчак, М. (2009). Структурная и функциональная динамика митохондрий при болезни Хантингтона. Brain Res. Ред. 61, 33–48. DOI: 10.1016 / j.expneurol.2009.03.042

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Редди, Х., Редди, Т. П. (2011). Митохондрии как терапевтическая мишень при старении и нейродегенеративных заболеваниях. Curr. Alzheimer Res. 8, 393–409. DOI: 10.2174 / 156720511795745401

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Рива Л., Коева М., Йилдирим Ф., Пирхаджи Л., Динеш Д., Мазор Т. и др. (2012). Гентингтин, увеличенный на основе поли-глутамина, резко изменяет связывание HSF1 по всему геному. J. Huntingtons Dis. 1, 33–45. DOI: 10.3233 / JHD-2012-120020

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ruan, Q., Лесорт, М., Макдональд, М.Э., и Джонсон, Г.В. (2004). Стриарные клетки от мутантных мышей с нокаутом гентингтина избирательно уязвимы к гибели клеток, индуцированной ингибитором митохондриального комплекса II, по неапоптотическому пути. Hum. Мол. Genet. 13, 669–681. DOI: 10.1093 / hmg / ddh082

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Сантос, С. Д., и Сараива, М. Дж. (2004). Увеличенные желудочки, астроглиоз и нейродегенерация в мозге мышей с нулевым фактором теплового шока 1. Неврология 126, 657–663. DOI: 10.1016 / j.neuroscience.2004.03.023

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Сен, Н., Сатия, Ю. К., и Дас, С. (2011). PGC-1α, ключевой модулятор p53, способствует выживанию клеток при метаболическом стрессе. Мол. Cell 44, 621–634. DOI: 10.1016 / j.molcel.2011.08.044

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Зингер, Э., Вальтер, К., Вебер, Дж. Дж., Краль, А. К., Мау-Хольцманн, У.A., Rischert, N., et al. (2017). Уменьшение размера клеток, хромосомные аберрации и изменение скорости пролиферации являются характеристиками и смешивающими факторами в клеточной модели STHdh при болезни Хантингтона. Sci. Реп. 7: 16880. DOI: 10.1038 / s41598-017-17275-4

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Sittler, A., Lurz, R., Lueder, G., Priller, J., Lehrach, H., Hayer-Hartl, M. K., et al. (2001). Гелданамицин активирует реакцию теплового шока и ингибирует агрегацию хантингтина в модели культуры клеток болезни Хантингтона. Hum. Мол. Genet. 10, 1307–1315. DOI: 10.1093 / hmg / 10.12.1307

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Соренсен, С.А., Фенгер, К., и Олсен, Дж. Х. (1999). Значительно более низкая заболеваемость раком среди пациентов с болезнью Хантингтона: апоптотический эффект расширенного полиглутаминового тракта? Рак 86, 1342–1346. DOI: 10.1002 / (sici) 1097-0142 (199) 86: 7 <1342 :: aid-cncr33> 3.0.co; 2-3

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Сквитьери, Ф., Каннелла, М., Сгарби, Г., Маглионе, В., Фаллени, А., Лензи, П. и др. (2006). Выраженные ультраструктурные изменения митохондрий в лимфобластах, гомозиготных по мутации при болезни Гентингтона. мех. Aging Dev. 127, 217–220. DOI: 10.1016 / j.mad.2005.09.010

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Сквитери, Ф., Фаллени, А., Каннелла, М., Оробелло, С., Фулсери, Ф., Лензи, П. и др. (2010). Аномальная морфология тканей периферических клеток у пациентов с болезнью Гентингтона. J. Neural Transm. 117, 77–83. DOI: 10.1007 / s00702-009-0328-4

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Стеффан, Дж. С., Казанцев, А., Спасич-Боскович, О., Гринвальд, М., Чжу, Ю. З., Гохлер, Х. и др. (2000). Белок болезни Хантингтона взаимодействует с p53 и CREB-связывающим белком и подавляет транскрипцию. Proc. Natl. Акад. Sci. U S A 97, 6763–6768. DOI: 10.1073 / pnas.100110097

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Сузуки, А., Цутоми, Ю., Ямамото, Н., Шибутани, Т., и Акахане, К. (1999). Митохондриальная регуляция клеточной смерти: митохондрии необходимы для образования комплекса прокаспаза 3 – p21, чтобы противостоять Fas-опосредованной гибели клеток. Мол. Клетка. Биол. 19, 3842–3847. DOI: 10.1128 / mcb.19.5.3842

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Тан К., Фудзимото М., Такии Р., Такаки Э., Хаясида Н. и Накаи А. (2015). Митохондриальный SSBP1 защищает клетки от протеотоксических стрессов, усиливая индуцированную стрессом транскрипционную активность HSF1. Нат. Commun. 6: 6580. DOI: 10.1038 / ncomms7580

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Тринклейн, Н. Д., Мюррей, Дж. И., Хартман, С. Дж., Ботштейн, Д., и Майерс, Р. М. (2004). Роль фактора транскрипции теплового шока 1 в регуляции реакции теплового шока млекопитающих на уровне всего генома. Мол. Биол. Cell 15, 1254–1261. DOI: 10.1091 / mbc.e03-10-0738

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Цунэми, Т., Эш, Т. Д., Моррисон, Б. Е., Сориано, К. Р., Ау, Дж., Роке, Р. А. и др. (2012). PGC-1α снимает протеотоксичность при болезни Хантингтона, предотвращая окислительный стресс и способствуя функции TFEB. Sci. Пер. Med. 4: 142ra97. DOI: 10.1126 / scitranslmed.3003799

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Утида, С., Хара, К., Кобаяси, А., Фудзимото, М., Оцуки, К., Ямагата, Х., и др. (2011). Нарушение спиногенеза и нейрогенеза гиппокампа и изменение аффективного поведения у мышей, лишенных фактора теплового шока 1. Proc. Natl. Акад. Sci. U S A 108, 1681–1686. DOI: 10.1073 / pnas.1016424108

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Вильнёв К., Гильбо-Фрюжье К., Сикард П., Лайрес О., Орденер К., Дюпарк Т. и др. (2013). Путь p53-PGC-1α опосредует окислительное повреждение митохондрий и некроз кардиомиоцитов, вызванный активацией моноаминоксидазы-A: роль в хронической дисфункции левого желудочка у мышей. Антиоксид. Редокс-сигнал. 18, 5–18.DOI: 10.1089 / ars.2011.4373

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Вейдт П., Пинеда В. В., Торренс А. Э., Либби Р. Т., Саттерфилд Т. Ф., Лазаровски Э. Р. и др. (2006). Нарушения терморегуляции и метаболизма у трансгенных мышей с болезнью Хантингтона причастны PGC-1α к нейродегенерации при болезни Гентингтона. Cell Metab. 4, 349–362. DOI: 10.1016 / j.cmet.2006.10.004

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Wu, Z., Пуигсервер, П., Андерссон, У., Чжан, К., Адельмант, Г., Мутха, В. и др. (1999). Механизмы, контролирующие митохондриальный биогенез и дыхание через термогенный коактиватор PGC-1. Cell 98, 115–124. DOI: 10.1016 / s0092-8674 (00) 80611-x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Сюй, Л., Ма, X., Багаттин, А., Мюллер, Э. (2016). Коактиватор транскрипции PGC1α защищает от гипертермического стресса за счет взаимодействия с фактором теплового шока HSF1. Cell Death Dis. 7: e2102. DOI: 10.1038 / cddis.2016.22

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ян, Л. Дж., Христианс, Э. С., Лю, Л., Сяо, X., Сохал, Р. С., и Бенджамин, И. Дж. (2002). Дефицит фактора транскрипции 1 теплового шока у мышей изменяет окислительно-восстановительный гомеостаз сердца и увеличивает окислительное повреждение митохондрий. EMBO J. 21, 5164–5172. DOI: 10.1093 / emboj / cdf528

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Дисфункция митохондрий и окислительный стресс при метаболических нарушениях — шаг к терапевтическим стратегиям, основанным на митохондриях

    Основные моменты

    Дисфункция митохондрий и окислительный стресс вовлечены в метаболические нарушения.

    АФК вызвали окислительное повреждение липидов, ДНК и белков.

    Митохондрии могут быть многообещающими терапевтическими мишенями для профилактики метаболических заболеваний.

    Abstract

    Митохондрии являются электростанциями клетки и участвуют в основных функциях клетки, включая производство АТФ, внутриклеточную регуляцию Ca 2 + , производство и удаление активных форм кислорода, регуляцию апоптотической гибели и активации клеток семейства протеаз каспаз.Дисфункция митохондрий и окислительный стресс в значительной степени участвуют в старении, раке, возрастном нейродегенеративном и метаболическом синдроме. За последнее десятилетие был достигнут огромный прогресс в понимании структуры, функции и их физиологии митохондрий при метаболических синдромах, таких как диабет, ожирение, инсульт и гипертония, а также сердечные заболевания. Кроме того, был достигнут прогресс в разработке терапевтических стратегий, включая изменения образа жизни (здоровое питание и регулярные упражнения), фармакологические стратегии и подходы, ориентированные на митохондрии.Эти стратегии были в основном направлены на снижение митохондриальной дисфункции и окислительного стресса, а также на поддержание качества митохондрий при метаболических синдромах. Цель нашей статьи — осветить недавний прогресс в изучении роли митохондрий в метаболических синдромах, а также суммировать прогресс молекул, нацеленных на митохондрии, в качестве терапевтических мишеней для лечения метаболических синдромов. Эта статья является частью специального выпуска, озаглавленного: Окислительный стресс и качество митохондрий при диабете / ожирении и критических заболеваниях — под редакцией П.Хемачандра Редди.

    Сокращения

    ATP

    Аденозинтрифосфат

    OXPHOS

    Окислительное фосфорилирование

    ROS

    Реактивные формы кислорода

    RNS

    Реактивные формы азота

    ETC

    Цепь переноса электронов

    (GPx)

    Глутатион-пероральный рецептор

    (GPxα)

    Глутатион 9000 Первичный рецептор альфа

    TNF-α

    Фактор некроза опухоли альфа

    T2DM

    Сахарный диабет 2 типа

    MitoQ

    Хинон, нацеленный на митохондрии

    SS31

    Пептид Сзето-Шиллера

    Окислительный стресс

    Активные формы кислорода

    Антиоксиданты, нацеленные на митохондрии

    Сердечно-сосудистые заболевания

    Предиабет

    Диабет 2 типа

    Ожирение

    Рекомендуемые статьи Цитирующие статьи (0) B.

    Else

    ©V.

    Рекомендуемые статьи

    Цитирующие статьи

    Клиника митохондриальных болезней — Клиническая геномика

    Клиника митохондриальных заболеваний

    Клиника митохондриальных заболеваний Мэйо укомплектована специализированной командой генетиков и консультантов по генетическим вопросам и координируется с несколькими специалистами и генетическими лабораториями.

    Митохондрии — это специализированные отделы в клетках вашего тела, которые отвечают за создание большей части энергии тела.Митохондриальные заболевания возникают в результате нарушения нормальной работы митохондрий. Это может привести к снижению энергии, повреждению клеток и их гибели. Наиболее частыми органами, которые могут быть повреждены, являются мозг, сердце, печень, мышцы, почки и эндокринная система.

    Митохондриальные болезни, проявляющиеся с раннего детства до зрелого возраста. В зависимости от конкретного типа митохондриального заболевания общие симптомы включают мышечную слабость, дисбаланс, желудочно-кишечные проблемы, плохой рост, болезни печени, сердечные заболевания, диабет, проблемы со зрением и слухом, лактоацидоз и задержку развития.Митохондриальные заболевания могут передаваться по наследству.

    Заболевания, оцениваемые в клинике Mayo’s Mitochondrial Disease Clinic, включают, среди прочего:

    • Прогрессирующая склерозирующая полиодистрофия Альперса (болезнь Альперса)
    • Синдром Барта
    • Хроническая прогрессирующая наружная офтальмоплегия (CPEO)
    • Доминирующая атрофия зрительного нерва
    • Атаксия Фридрейха
    • Наследственная параганглиома
    • Наследственная спастическая параплегия
    • Синдром Кернса-Сейра
    • Наследственная оптическая нейропатия Лебера
    • Ли-и-подобный синдром
    • Митохондриальная энцефалопатия, лактоацидоз и эпизоды, похожие на инсульт (MELAS)
    • Миоклоническая эпилепсия с рваными красными волокнами (MERRF)
    • Невропатия, атаксия и пигментный ретинит (НАРП)
    • Синдром Пирсона
    • Синдром Вольфрама

    Пациенты, наблюдаемые в нашей клинике митохондриальных заболеваний, также имеют возможность участвовать в Североамериканском консорциуме по митохондриальным заболеваниям.

    Добавить комментарий

    Ваш адрес email не будет опубликован.